|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 7 August 2007
doi: 10.1242/jcs.009613
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |

1 Inserm, U839, Paris F-75005, France
2 Université Pierre et Marie Curie, Paris F-75005, France
3 Institut du Fer à Moulin, Paris F-75005, France
4 Molecular Neurobiology Research Group, Institute of Basic Medical Sciences, University of Oslo, 0317 Oslo, Norway
Author for correspondence (e-mail: girault{at}fer-a-moulin.inserm.fr)
Accepted 25 June 2007
| Summary |
|---|
|
|
|---|
Key words: Tyrosine kinase, Protein phosphatase, Nucleus
| Introduction |
|---|
|
|
|---|
(CAK
) (Sasaki et al., 1995
The most striking characteristic of PYK2 is its activation following increases in cytosolic free Ca2+ (Lev et al., 1995
). The mechanism of this activation, however, is not understood. In many cell types activation of PYK2 appears to involve protein kinase C (PKC) (Lev et al., 1995
; Siciliano et al., 1996
) and, in some cases, a Ca2+-calmodulin-dependent protein kinase (Zwick et al., 1999
). The phosphorylation reactions mediating directly or indirectly the activation of PYK2 remain to be identified. Increases in Ca2+ lead to PYK2 autophosphorylation on Tyr402, creating a Src-homology-2 (SH2) binding site that recruits Src family kinases, which phosphorylate other tyrosine residues of PYK2 and associated proteins (Dikic et al., 1996
; Park et al., 2004
). Interactions between the activated PYK2-Src module and proteins such as the Grb2-Sos complex, p130Cas, paxillin and Graf regulate multiple intracellular signaling pathways (reviewed by Avraham et al., 2000
).
PYK2 possesses a C-terminal focal adhesion targeting (FAT) domain very similar to that of FAK (61% identity), although in most cells PYK2 is not enriched at focal contacts. Transfected PYK2 is generally expressed in the cytoplasm (Schaller and Sasaki, 1997
; Zheng et al., 1998
), whereas endogenous PYK2 can be observed in perinuclear punctuate structures (Sieg et al., 1998
) or, for a fraction, at focal adhesions (Du et al., 2001
). In neurons, PYK2 is mostly localized in perikarya and dendritic shafts (Corvol et al., 2005
; Menegon et al., 1999
). Although it is likely that PYK2 plays an important role in post-synaptic densities, because of its interaction with NMDA receptors and associated scaffold proteins (Bongiorno-Borbone et al., 2005
; Cheung et al., 2000
; Heidinger et al., 2002
; Liu et al., 2001
; Seabold et al., 2003
), it does not appear to be enriched in spines. By contrast, deleted or mutated forms of PYK2 accumulate in the nucleus of transfected COS-7 cells (Aoto et al., 2002
) and PYK2 is localized in the nucleus in chondrocytes and keratinocytes (Arcucci et al., 2006
; Schindler et al., 2007
). In rat brain, following ischemia or convulsions, PYK2 immunoreactivity appears to be in part nuclear (Tian et al., 2000
). However, the significance of these observations is not known.
|
| Results |
|---|
|
|
|---|
In the absence of depolarization, there were few neurons with nuclear PYK2 immunoreactivity in the CA1 region of hippocampus (Fig. 1A). When the extracellular concentration of K+ ([K+]o) was raised by 40 mM for 2 minutes a striking accumulation of PYK2 was observed in the nuclei of neurons in CA1. Counting PYK2-immunoreactive nuclei showed that approximately 40% of nuclei were labeled in depolarized slices (Fig. 1B). PYK2 nuclear translocation was rapid and transient since it was observed within 2 minutes after the onset of depolarization and disappeared after 10 minutes (Fig. 1C).
Depolarization of hippocampal slices increases PYK2 autophosphorylation on Tyr402 and its phosphorylation by Src-family kinases (Corvol et al., 2005
; Siciliano et al., 1996
). We investigated the role of Src recruitment in the depolarization-induced nuclear translocation of PYK2, using PP2, a Src-family inhibitor that inhibits tyrosine phosphorylation of PYK2 in depolarized hippocampal slices, without altering phosphorylation of Tyr402 (Corvol et al., 2005
). Pretreatment of hippocampal slices with PP2 decreased dramatically depolarization-induced PYK2 tyrosine phosphorylation and Src autophosphorylation (Fig. 1D). However, this treatment did not alter high [K+]o-induced PYK2 translocation to the nucleus (Fig. 1E,F), showing that Src-family kinases activation was not necessary for PYK2 redistribution.
Tetanic stimulation of afferent fibers induces PYK2 nuclear translocation in CA1 neurons
We next examined whether synaptic activation of neurons in response to electrical stimulation of afferent fibers (Schaeffer collaterals) in the CA1 region of mouse hippocampus altered PYK2 subcellular localization. In unstimulated slices, PYK2 immunoreactivity examined by confocal microscopy was localized mainly in the cytoplasm and dendritic shafts (Fig. 2A upper panel). After high [K+]o, PYK2 immunostaining in the nucleus was greater or equal to that in the cytoplasm in 75% of PYK2-immunoreactive cells (Fig. 2A upper panels, B). Electrical stimulation of afferent fibers of CA1 pyramidal cells (100 Hz for 1 second, four times at 10-second intervals) induced a potentiation of synaptic transmission (Fig. 2C) and triggered nuclear accumulation of PYK2 immunoreactivity (Fig. 2A,B). In the same experimental conditions, we studied phosphorylation of Tyr402, using phosphorylation state-specific antibodies (Fig. 2A lower panels). Virtually no immunofluorescence was observed in control slices, whereas a dramatic increase in pY402-PYK2 immunoreactivity was observed after high [K+]o-induced depolarization or electric stimulation of Schaeffer collaterals. Immunofluorescence was observed in dendrites and perikarya, but was more intense in the nuclei. These results revealed that synaptic activation of hippocampal pyramidal neurons, as well as direct depolarization, induced a nuclear translocation of PYK2 and that its autophosphorylated form also accumulated in the nucleus.
|
70% of the neurons in primary cultures in basal conditions, whereas 3 minutes after depolarization, it was detected predominantly in the nucleus in
85% of the neurons (Fig. 3B). This high [K+]o-induced nuclear accumulation of PYK2 was confirmed by confocal microscopy analysis (Fig. 3C). As the major consequence of depolarization is the opening of voltage-gated Ca2+ channels and the increase in intracellular Ca2+ levels, we examined if PYK2 nuclear translocation was Ca2+-dependent in hippocampal neurons in culture. Pretreatment with EGTA prevented the change in PYK2 localization (Fig. 3A,B), demonstrating that PYK2 nuclear translocation required Ca2+ entry.
|
Depolarization induces nuclear accumulation of PYK2 in PC12 cells
We then used PC12 cells, a cell line with neuronal characteristics, to further investigate the mechanisms involved in the depolarization-induced nuclear translocation of PYK2 (Fig. 4A). Subcellular distribution of endogenous PYK2 was classified into three classes (n<c, n=c and n>c) depending on whether nuclear labeling intensity was less, equal or greater than cytoplasmic labeling, respectively. In this model, high [K+]o depolarization triggered PYK2 translocation, as evidenced by its colocalization with DAPI (Fig. 4A,B). Depolarization also increased pY402-PYK2 immunoreactivity, which was detected in the cytoplasm and nuclei of PC12 cells (Fig. 4C,D). As in hippocampal slices, in depolarized PC12 cells PP2 caused a dramatic decrease in tyrosine phosphorylation of PYK2 (supplementary material Fig. S1A,B) but did not alter high [K+]o-induced PYK2 translocation to the nucleus (supplementary material Fig. S1C,D).
|
Many cytoplasmic proteins undergo a constant cyto-nuclear shuttling, which is unmasked by treatment with leptomycin B, an antibiotic blocking CRM1 (also known as exportin 1)-mediated nuclear export (Nishi et al., 1994
). When PC12 cells were treated with leptomycin B for 3 hours, an increase in PYK2 nuclear staining was observed (Fig. 4A,B). However, quantification showed that the effects of leptomycin B on the nuclear accumulation of PYK2 were much weaker than those of depolarization (Fig. 4B).
|
|
We then examined the subcellular localization of transfected wild-type or mutant GFP-PYK2 fusion proteins in response to depolarization (Fig. 6B). Wild type, Y402F and K457A GFP-PYK2 displayed a similar nuclear translocation after K+ depolarization (Fig. 6B,C), demonstrating that PYK2 autophosphorylation and kinase activity are not necessary for depolarization-induced PYK2 nuclear translocation.
In the course of these experiments, we noticed on immunoblots a slight downward shift of the endogenous PYK2 band in samples from K+-treated cells (Fig. 6A, see also Fig. 1D in slices). To further investigate this observation, small amounts of protein from control or K+-treated PC12 cells were loaded on a 7% acrylamide-bisacrylamide gel and migration time was increased. This resulted in a distinct shift of endogenous PYK2 in depolarized PC12 cells, towards a lower apparent molecular mass (Fig. 6D). Several mechanisms could account for this accelerated gel mobility, including dephosphorylation. As depolarization induces a marked increase in PYK2 tyrosine phosphorylation, such dephosphorylation would be expected to occur on Ser/Thr residues.
|
In order to rule out a non-calcineurin-mediated effect of cyclosporin A, we used FK506 an immunosuppressant structurally unrelated to cyclosporin A, which inhibits calcineurin by interacting with a different immunophilin (Rusnak and Mertz, 2000
). Pretreatment of PC12 cells with FK506 (1 µM, 30 minutes before high K+) prevented the depolarization-induced increase in endogenous PYK2 tyrosine phosphorylation (Fig. 7E,F) and specifically the phosphorylation of Tyr402 (Fig. 7E,G). Depolarization-induced translocation of GFP-PYK2 was also completely prevented in FK506-pretreated PC12 cells (Fig. 7H,I). Similar results were obtained with hippocampal slices pretreated with FK506 (supplementary material Fig. S2). Since we have shown above that nuclear translocation of PYK2 did not require its tyrosine phosphorylation, these results strongly indicate that Ca2+-induced activation of calcineurin is necessary for two independent events, the autophosphorylation of PYK2 and subsequent recruitment of Src-family kinases, and the nuclear translocation of PYK2.
Depolarization-induced tyrosine phosphorylation of PYK2 is prevented by a dominant-negative form of calcineurin
Calcineurin is a heterodimer of a catalytic (CnA) subunit and a regulatory (CnB) subunit (Klee et al., 1998
). CnA encompasses several domains: a catalytic domain, a CnB-binding domain, a calmodulin-binding domain and an autoinhibitory domain. To test the role of calcineurin in PYK2 tyrosine phosphorylation we used a Flag-tagged CnA construct (1-397) deleted from its autoinhibitory domain and bearing a point mutation in its catalytic site (H151Q, phosphatase-dead, PD-CnA) which behaves as a dominant-negative inhibitor of calcineurin (Kahl and Means, 2004
). We co-transfected GFP-PYK2 and PD-CnA or vector, and cells were treated with a control solution or a high [K+]o depolarizing solution (Fig. 8). Depolarization-induced tyrosine phosphorylation of GFP-PYK2 was dramatically decreased in PD-CnA co-transfected cells (Fig. 8A,B). Since cotransfection of PD-CnA slightly decreased the expression of GFP-PYK2, we normalized the amount of tyrosine-phosphorylated GFP-PYK2 to the amount of total GFP-PYK2 protein: depolarization-induced increase in tyrosine phosphorylation was 80±18% in mock-cotransfected cells and 24±3% in PD-CnA-cotransfected cells. Thus, these results strongly supported the implication of endogenous calcineurin in this response.
|
|
| Discussion |
|---|
|
|
|---|
Increases in cytosolic free Ca2+ trigger PYK2 autophosphorylation and the recruitment of Src family kinases, which in turn phosphorylate multiple tyrosines of PYK2 (Lev et al., 1995
). Since nuclear translocation of PYK2 was also Ca2+-dependent and PYK2 activation and nuclear translocation occurred concomitantly, we tested whether nuclear translocation involved PYK2 tyrosine phosphorylation. Clearly, PYK2 nuclear translocation did not require its tyrosine phosphorylation. By contrast, nuclear translocation of PYK2 was prevented by pretreatment of PC12 cells with two calcineurin inhibitors, cyclosporin A and FK506, which act through binding to different immunophilins. Calcineurin inhibition also blocked depolarization-induced PYK2 tyrosine autophosphorylation and subsequently tyrosine phosphorylation by Src family kinases. The role of calcineurin was confirmed by transfection of dominant-negative or constitutively active forms of this enzyme in PC12 cells. These results strongly indicate that Ca2+-activated calcineurin simultaneously triggers two independent events: autophosphorylation of PYK2 on Tyr402 and nuclear translocation of PYK2. As tyrosine phosphorylation of PYK2 is not necessary for its nuclear translocation, it is likely that calcineurin acts upstream from these two events.
Cyto-nuclear shuttling of many proteins is regulated by Ser/Thr phosphorylation events (Poon and Jans, 2005
). A well characterized example is the translocation of the nuclear factor of activated T cells (NFAT) triggered by calcineurin-mediated dephosphorylation of Ser/Thr residues located near a nuclear localization sequence (Crabtree and Olson, 2002
). Our results reveal that calcineurin also plays a critical role in the regulation of PYK2 nuclear redistribution. Calcineurin may dephosphorylate Ser/Thr residues in PYK2 or in associated proteins. PYK2, as the related FAK, contains many potential serine and threonine phosphorylation sites, some of which are known to be phosphorylated (Grigera et al., 2005
; Wissing et al., 2006
). Regulation of PYK2 by serine/threonine phosphorylation is likely to be complex since several protein kinases including protein kinase C and Ca2+-calmodulin-dependent kinases appear to be involved (Lev et al., 1995
; Siciliano et al., 1996
; Zwick et al., 1999
). The mechanism of action of dephosphorylation can only be speculative at this time. In transfected COS-7 cells nuclear accumulation of PYK2 was promoted by mutation of Pro859 to Ala (Aoto et al., 2002
), whereas in chondrocytes a N-terminally truncated form of PYK2 was detected in the nucleus (Arcucci et al., 2006
). Possible interpretations of these findings are that mutation or truncation releases PYK2 from a cytoplasmic anchor and/or modifies the exposition of nuclear localization sequences. Our results suggest that such processes could be triggered by Ser/Thr dephosphorylation, in response to a physiological stimulus raising intracellular Ca2+. PYK2 does not have a canonical nuclear localization sequence, indicating that its nuclear import involves a different targeting motif or association with other proteins. Studies are in progress to clarify these issues.
Altogether, our results provide novel information regarding PYK2 regulation and function. Although this tyrosine kinase was initially described as activating cytoplasmic signaling pathways, our results show that it may have an important function in the nucleus. Interestingly, in keratinocytes PYK2 is constitutively nuclear and appears to be involved in Jun-D and Fra1 expression (Schindler et al., 2007
). It has also been reported that PYK2 and calcineurin are involved in the control of serum response element by muscarinic receptors (Lin et al., 2002
). Thus, it is tempting to speculate that, in neurons, PYK2 regulates nuclear functions important for long-lasting plasticity, in response to Ca2+ entry. Interestingly, the related kinase FAK can also undergo a nuclear translocation in some specific conditions or cell types (Yi et al., 2006
), and can be sumoylated (Kadare et al., 2003
), a post-translational modification which usually takes place in the nucleus. These observations suggest that PYK2 and possibly FAK, under specific circumstances, play a role in the control of nuclear functions such as RNA transcription or processing.
Another important implication of the present study is that inhibition of PYK2 must be considered among the relevant targets of calcineurin inhibitors. These drugs are powerful and useful immunosuppressants, known to act by preventing NFAT activation in lymphocytes. As PYK2 is involved in maturation of specific B cell populations (Guinamard et al., 2000
) and in macrophage activation (Okigaki et al., 2003
), prevention of its activation through inhibition of calcineurin may contribute to the immunosuppressive effects of FK506 and cyclosporin A. Interestingly calcineurin inhibitors have also been reported to exert protective effects in cardiac hypertrophy, attributed to NFAT activation (Heineke and Molkentin, 2006
). As PYK2 is also a critical player in some forms of cardiac hypertrophy (Hirotani et al., 2004
), our results raise the intriguing possibility that some of the cardioprotective effects of calcineurin inhibitors are mediated by PYK2 inhibition. Finally, it should be pointed out that FK506 or cyclosporin A may possibly be a useful means of indirectly inhibiting PYK2 activation in pathological conditions, including osteoclastic bone resorption and in some cancers.
| Materials and Methods |
|---|
|
|
|---|
Mouse hippocampal slices for electrophysiology
Hippocampal slices were prepared from desflurane-anesthetized B6CBA mice (older than 60 days). Transverse slices (400 µm) were cut from the middle portion of each hippocampus with a vibroslicer in artificial cerebrospinal fluid (ACSF, 4°C, bubbled with 95% O2 and 5% CO2, pH 7.4), placed in a humidified interface chamber at 30±1°C and perfused with ACSF containing 2 mM CaCl2. Orthodromic stimuli (50 µseconds, <300 µA, 0.1 Hz) were delivered alternately through two tungsten electrodes, in the stratum radiatum of the CA1 region. Extracellular synaptic responses were monitored by two ACSF-filled glass electrodes placed in the corresponding synaptic layers. After obtaining stable synaptic responses in both pathways (0.1 Hz stimulation) for at least 10-15 minutes, the slices were exposed to one of the following three procedures: (1) in the control group synaptic responses were monitored during low frequency stimulation (0.1 Hz) to ascertain the viability of the slices and fixed; (2) in the high [K+]out group, synaptic responses were monitored before and during exposure to 40 mM K+; (3) in the tetanization group synaptic responses were monitored before and 4-6 minutes following a tetanization procedure, which consisted of 1-second 100 Hz stimulation given four times (10-second interval) alternatively to each of the radiatum pathways. The stimulation strength used for tetanization was well above threshold for generation of a population spike in response to a single test shock. Synaptic efficacy was assessed by measuring the slope of the synaptic field excitatory post-synaptic potentials (fEPSPs) in the middle third of their rising phase, and normalized to stable control recordings. At the end of the recordings, slices were fixed as described below.
Immunofluorescent staining of hippocampal slices
Rat hippocampal slices (300 µm) were prepared from young male Sprague-Dawley rats (100–150 g) with a McIlwain tissue chopper and incubated as previously described (Corvol et al., 2005
; Siciliano et al., 1996
). Slices from rat or mouse were placed in paraformaldehyde (4% weight/vol.) in PBS at 4°C overnight, and then stored at 4°C in PBS. Sections (30-µm) were cut with a microtome (Leica) from agarose-embedded slices and kept at –20°C in a solution containing 30% ethylene glycol, 30% glycerol, and 0.1 M phosphate buffer. Immunolabeling procedures were as described previously (Valjent et al., 2000
) using Alexa Fluor 488- or Cy3-coupled secondary antibodies. Sections were mounted in Vectashield with 4
, 6-diamidino-2-phenylindole (DAPI) counterstain (Vector Laboratories) and studied using laser scanning confocal microscopy (SP2, Leica).
Cell cultures
Low-density primary cultures of hippocampal neurons were prepared from rat embryos (E18). Hippocampal cells were dissociated and plated at a density of 20,000/cm2 on polylysine-coated glass coverslips in Neurobasal-B27 (Neurobasal, Invitrogen). PC12 cells were grown on type I collagen-coated dishes (BD Biosciences) in RPMI medium (GIBCO) containing 10% horse serum, 5% fetal calf serum. Transfections were done with Lipofectamine 2000 (Invitrogen). For fluorescence analysis, PC12 cells were grown in RPMI on type I collagen-coated glass coverslips after incubation with poly-L-lysine (Sigma). For 40 mM K+-induced depolarization of cells in culture, half of the cell culture medium was removed and replaced for 3 minutes by a solution containing 1 mM MgCl2, 2 mM CaCl2, 25 mM Hepes and either 135 mM NaCl, (control solution), or 55 mM NaCl, 80 mM KCl (high [K+]o). In both cases, the osmolarity of the solution remained 300 mOsm/l.
Cell cultures immunofluorescence
Cells were fixed for 15 minutes in a solution containing 4% (weight/vol) paraformaldehyde, permeabilized on ice with methanol-acetone (vol./vol.) for 12 minutes. Cells were washed with PBS, blocked and incubated for 2 hours with primary antibodies [anti-PYK2 antibody (1/100), anti-phospho-Tyr402 (1/200) and mouse anti-flag M2 monoclonal antibody (1/250)]. After washes, cells were incubated with Alexa Fluor 488- or Cy3-coupled secondary antibodies (1/400) for 45 minutes, washed and mounted in Vectashield with DAPI. PC12 cells transfected with GFP-PYK2 constructs were fixed, washed and mounted in Vectashield with DAPI. Images were acquired with a digital camera CCD Micromax (Roper Scientific) or with a confocal microscope Leica SP2.
Immunoprecipitation and immunoblot analysis
PC12 cells were lysed on ice, in RIPA buffer [1% Triton X-100, 0.5% (weight/vol.) deoxycholate, 0.1% (weight/vol.) SDS, 50 mM Tris (pH 7.4), 150 mM NaCl, 1 mM sodium orthovanadate, 50 mM NaF, 10 mM sodium pyrophosphate and protease inhibitors (Complete Boehringer 1/20)]. Immunoprecipitations and immunoblot were carried out as described previously (Derkinderen et al., 2001
). Quantifications were carried out by scanning the autoradiograms and measuring relative optical density with Scion Image software, or by direct measurement using the Odyssey imaging system (Li-Cor Bioscences, Lincoln, NE). Data were normalized to the mean value of untreated controls in the same autoradiograms.
Cloning and directed mutagenesis
A plasmid encoding the N terminus of rat PYK2 (1-364) was fused to green fluorescent protein by ligating the BamHI-SalI fragment of PYK2 into the BglII-SalI sites of pEGFP-C1 (Clontech). Full-length PYK2 was obtained by ligating the ScaI-BamHI fragment of PYK2 into the ScaI-BamHI sites of this construct. The Y402F and K457A mutants of PYK2 were prepared by site-directed mutagenesis (QuikChange, Stratagene). The HindIII fragment of PYK2 was subcloned into the HindIII site of pBlueScript KS (Fermentas). Oligonucleotides to change Y402 to phenylalanine and K457 to alanine were GCATAGAGTCAGACATCTTTGCAGAGATTCCTGATGAGACCC and GGGAAAAAATTAATGTGGCCGTCGCGACCTGTAAGAAAGATTGTACCC, respectively. Mutations were verified by DNA sequencing. Plasmids encoding constitutively active calcineurin A (CnA) (residues 1-397, CA-CnA), and mutated CnA (H151Q) were a gift from A. Means and were subcloned into the BglII-SmaI sites of FLAG-CMV2 expression vector (Sigma). The H151Q CnA mutant was truncated and the phosphatase-dead form used in the study was PD-CnA 1-397 H151Q.
Quantifications and statistical analysis
Cells were classified in three categories by observers blind to the treatment: cytoplasmic fluorescence more intense than nuclear fluorescence (c>n), cytoplasmic equal to nuclear fluorescence (c=n) or cytoplasmic inferior to nuclear fluorescence (c<n). The boundaries of the nuclei were determined by DAPI staining. The percentage of cells in each category was determined for each coverslip (approximately 50-100 cells per coverslip in 10-20 fields). Data are from at least three independent experiments each in duplicate. Statistical analysis was done using GraphPad Prism 3.02.
| Acknowledgments |
|---|
| Footnotes |
|---|
* These authors contributed equally to this work ![]()
| References |
|---|
|
|
|---|
Aoto, H., Sasaki, H., Ishino, M. and Sasaki, T. (2002). Nuclear translocation of cell adhesion kinase beta/proline-rich tyrosine kinase 2. Cell Struct. Funct. 27, 47-61.[CrossRef][Medline]
Arcucci, A., Montagnani, S. and Gionti, E. (2006). Expression and intracellular localization of Pyk2 in normal and v-src transformed chicken epiphyseal chondrocytes. Biochimie 88, 77-84.[Medline]
Avraham, S., London, R., Fu, Y. G., Ota, S., Hiregowdara, D., Li, J. Z., Jiang, S. X., Pasztor, L. N., White, R. A., Groopman, J. E. et al. (1995). Identification and characterization of a novel related adhesion focal tyrosine kinase (RAFTK) from megakaryocytes and brain. J. Biol. Chem. 270, 27742-27751.
Avraham, H., Park, S. Y., Schinkmann, K. and Avraham, S. (2000). RAFTK/Pyk2-mediated cellular signalling. Cell. Signal. 12, 123-133.[CrossRef][Medline]
Bongiorno-Borbone, L., Kadare, G., Benfenati, F. and Girault, J. A. (2005). FAK and PYK2 interact with SAP90/PSD-95-associated protein-3. Biochem. Biophys. Res. Commun. 337, 641-646.[CrossRef][Medline]
Cheung, H. H., Takagi, N., Teves, L., Logan, R., Wallace, M. C. and Gurd, J. W. (2000). Altered association of protein tyrosine kinases with postsynaptic densities after transient cerebral ischemia in the rat brain. J. Cereb. Blood Flow Metab. 20, 505-512.[CrossRef][Medline]
Corvol, J. C., Valjent, E., Toutant, M., Enslen, H., Irinopoulou, T., Lev, S., Herve, D. and Girault, J. A. (2005). Depolarization activates ERK and proline-rich tyrosine kinase 2 (PYK2) independently in different cellular compartments in hippocampal slices. J. Biol. Chem. 280, 660-668.
Crabtree, G. R. and Olson, E. N. (2002). NFAT signaling: choreographing the social lives of cells. Cell 109, S67-S79.[CrossRef][Medline]
Derkinderen, P., Siciliano, J., Toutant, M. and Girault, J. A. (1998). Differential regulation of FAK+ and PYK2/Cak
, two related tyrosine kinases, in rat hippocampal slices: effects of LPA, carbachol, depolarization and hyperosmolarity. Eur. J. Neurosci. 10, 1667-1675.[CrossRef][Medline]
Derkinderen, P., Toutant, M., Kadaré, G., Ledent, C., Parmentier, M. and Girault, J. A. (2001). Dual role of Fyn in the regulation of FAK+6,7 by cannabinoids in hippocampus. J. Biol. Chem. 276, 38289-38296.
Dikic, I., Tokiwa, G., Lev, S., Courtneidge, S. A. and Schlessinger, J. (1996). A role for Pyk2 and Src in linking G-protein-coupled receptors with MAP kinase activation. Nature 383, 547-550.[CrossRef][Medline]
Du, Q. S., Ren, X. R., Xie, Y., Wang, Q., Mei, L. and Xiong, W. C. (2001). Inhibition of PYK2-induced actin cytoskeleton reorganization, PYK2 autophosphorylation and focal adhesion targeting by FAK. J. Cell Sci. 114, 2977-2987.[Medline]
Girault, J. A., Costa, A., Derkinderen, P., Studler, J. M. and Toutant, M. (1999). FAK and PYK2/CAK in the nervous system, a link between neuronal activity, plasticity and survival? Trends Neurosci. 22, 257-263.[CrossRef][Medline]
Grigera, P. R., Jeffery, E. D., Martin, K. H., Shabanowitz, J., Hunt, D. F. and Parsons, J. T. (2005). FAK phosphorylation sites mapped by mass spectrometry. J. Cell Sci. 118, 4931-4935.
Guinamard, R., Okigaki, M., Schlessinger, J. and Ravetch, J. V. (2000). Absence of marginal zone B cells in Pyk-2-deficient mice defines their role in the humoral response. Nat. Immunol. 1, 31-36.[CrossRef][Medline]
Heidinger, V., Manzerra, P., Wang, X. Q., Strasser, U., Yu, S. P., Choi, D. W. and Behrens, M. M. (2002). Metabotropic glutamate receptor 1-induced upregulation of NMDA receptor current: mediation through the Pyk2/Src-family kinase pathway in cortical neurons. J. Neurosci. 22, 5452-5461.
Heineke, J. and Molkentin, J. D. (2006). Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat. Rev. Mol. Cell Biol. 7, 589-600.[CrossRef][Medline]
Henley, J. M. and Nishimune, A. (2001). CAKbeta/Pyk2 activates Src: another piece in the puzzle of LTP induction. Neuron 29, 312-314.[CrossRef][Medline]
Hirotani, S., Higuchi, Y., Nishida, K., Nakayama, H., Yamaguchi, O., Hikoso, S., Takeda, T., Kashiwase, K., Watanabe, T., Asahi, M. et al. (2004). Ca(2+)-sensitive tyrosine kinase Pyk2/CAK beta-dependent signaling is essential for G-protein-coupled receptor agonist-induced hypertrophy. J. Mol. Cell. Cardiol. 36, 799-807.[CrossRef][Medline]
Huang, Y., Lu, W., Ali, D. W., Pelkey, K. A., Pitcher, G. M., Lu, Y. M., Aoto, H., Roder, J. C., Sasaki, T., Salter, M. W. et al. (2001). CAKbeta/Pyk2 kinase is a signaling link for induction of long-term potentiation in CA1 hippocampus. Neuron 29, 485-496.[CrossRef][Medline]
Kadare, G., Toutant, M., Formstecher, E., Corvol, J. C., Carnaud, M., Boutterin, M. C. and Girault, J. A. (2003). PIAS1-mediated sumoylation of focal adhesion kinase activates its autophosphorylation. J. Biol. Chem. 278, 47434-47440.
Kahl, C. R. and Means, A. R. (2004). Calcineurin regulates cyclin D1 accumulation in growth-stimulated fibroblasts. Mol. Biol. Cell 15, 1833-1842.
Klee, C. B., Ren, H. and Wang, X. T. (1998). Regulation of the calmodulin-stimulated protein phosphatase, calcineurin. J. Biol. Chem. 273, 13367-13370.
Lakkakorpi, P. T., Bett, A. J., Lipfert, L., Rodan, G. A. and Duong, L. T. (2003). PYK2 autophosphorylation, but not kinase activity, is necessary for adhesion-induced association with c-Src, osteoclast spreading, and bone resorption. J. Biol. Chem. 278, 11502-11512.
Lev, S., Moreno, H., Martinez, R., Canoll, P., Peles, E., Musacchio, J. M., Plowman, G. D., Rudy, B. and Schlessinger, J. (1995). Protein tyrosine kinase PYK2 involved in Ca2+-induced regulation of ion channel and MAP kinase functions. Nature 376, 737-745.[CrossRef][Medline]
Lin, K., Wang, D. and Sadée, W. (2002). Serum response factor activation by muscarinic receptors via Rho: a novel pathway specific to m1 subtype involving calmodulin, calcineurin, and PYK2. J. Biol. Chem. 277, 40789-40798.
Lipinski, C. A., Tran, N. L., Bay, C., Kloss, J., McDonough, W. S., Beaudry, C., Berens, M. E. and Loftus, J. C. (2003). Differential role of proline-rich tyrosine kinase 2 and focal adhesion kinase in determining glioblastoma migration and proliferation. Mol. Cancer Res. 1, 323-332.
Liu, J., Farmer, J. D., Lane, W. S., Friedman, J., Weissman, I. and Schreiber, S. L. (1991). Calcineurin is a common target of cyclophilin-cyclosporin A and FKBP-FK506 complexes. Cell 66, 807-815.[CrossRef][Medline]
Liu, Y., Zhang, G., Gao, C. and Hou, X. (2001). NMDA receptor activation results in tyrosine phosphorylation of NMDA receptor subunit 2A(NR2A) and interaction of Pyk2 and Src with NR2A after transient cerebral ischemia and reperfusion. Brain Res. 909, 51-58.[CrossRef][Medline]
Menegon, A., Burgaya, F., Baudot, P., Dunlap, D. D., Girault, J. A. and Valtorta, F. (1999). FAK+ and PYK2/CAK
, two related tyrosine kinases highly expressed in the central nervous system: similarities and differences in the expression pattern. Eur. J. Neurosci. 11, 3777-3788.[CrossRef][Medline]
Nishi, K., Yoshida, M., Fujiwara, D., Nishikawa, M., Horinouchi, S. and Beppu, T. (1994). Leptomycin B targets a regulatory cascade of crm1, a fission yeast nuclear protein, involved in control of higher order chromosome structure and gene expression. J. Biol. Chem. 269, 6320-6324.
Okigaki, M., Davis, C., Falasca, M., Harroch, S., Felsenfeld, D. P., Sheetz, M. P. and Schlessinger, J. (2003). Pyk2 regulates multiple signaling events crucial for macrophage morphology and migration. Proc. Natl. Acad. Sci. USA 100, 10740-10745.
Park, S. Y., Avraham, H. K. and Avraham, S. (2004). RAFTK/Pyk2 activation is mediated by trans-acting autophosphorylation in a Src-independent manner. J. Biol. Chem. 279, 33315-33322.
Poon, I. K. and Jans, D. A. (2005). Regulation of nuclear transport: central role in development and transformation? Traffic 6, 173-186.[CrossRef][Medline]
Rusnak, F. and Mertz, P. (2000). Calcineurin: form and function. Physiol. Rev. 80, 1483-1521.
Sasaki, H., Nagura, K., Ishino, M., Tobioka, H., Kotani, K. and Sasaki, T. (1995). Cloning and characterization of cell adhesion kinase
, a novel protein-tyrosine kinase of the focal adhesion kinase subfamily. J. Biol. Chem. 270, 21206-21219.
Schaller, M. D. and Sasaki, T. (1997). Differential signaling by the focal adhesion kinase and cell adhesion kinase
. J. Biol. Chem. 272, 25319-25325.
Schindler, E. M., Baumgartner, M., Gribben, E. M., Li, L. and Efimova, T. (2007). The role of proline-rich protein tyrosine kinase 2 in differentiation-dependent signaling in human epidermal keratinocytes. J. Invest. Dermatol. 127, 1094-1106.[CrossRef][Medline]
Seabold, G. K., Burette, A., Lim, I. A., Weinberg, R. J. and Hell, J. W. (2003). Interaction of the tyrosine kinase Pyk2 with the N-methyl-D-aspartate receptor complex via the Src homology 3 domains of PSD-95 and SAP102. J. Biol. Chem. 278, 15040-15048.
Siciliano, J. C., Toutant, M., Derkinderen, P., Sasaki, T. and Girault, J. A. (1996). Differential regulation of proline-rich tyrosine kinase 2 cell adhesion kinase
(PYK2/CAK
) and pp125FAK by glutamate and depolarization in rat hippocampus. J. Biol. Chem. 271, 28942-28946.
Sieg, D. J., Ilic, D., Jones, K. C., Damsky, C. H., Hunter, T. and Schlaepfer, D. D. (1998). Pyk2 and Src-family protein-tyrosine kinases compensate for the loss of FAK in fibronectin-stimulated signaling events but Pyk2 does not fully function to enhance FAK- cell migration. EMBO J. 17, 5933-5947.[CrossRef][Medline]
Tian, D., Litvak, V. and Lev, S. (2000). Cerebral ischemia and seizures induce tyrosine phosphorylation of PYK2 in neurons and microglial cells. J. Neurosci. 20, 6478-6487.
Valjent, E., Corvol, J. C., Pages, C., Besson, M. J., Maldonado, R. and Caboche, J. (2000). Involvement of the extracellular signal-regulated kinase cascade for cocaine-rewarding properties. J. Neurosci. 20, 8701-8709.
Wissing, J., Jansch, L., Nimtz, M., Dieterich, G., Hornberger, R., Keri, G., Wehland, J. and Daub, H. (2006). Proteomic analysis of protein kinases by target class-selective pre-fractionation and tandem mass spectrometry. Mol. Cell. Proteomics 6, 537-547.[CrossRef][Medline]
Yi, X. P., Zhou, J., Huber, L., Qu, J., Wang, X., Gerdes, A. M. and Li, F. (2006). Nuclear compartmentalization of FAK and FRNK in cardiac myocytes. Am. J. Physiol. Heart Circ. Physiol. 290, H2509-H2515.
Yu, H., Li, X., Marchetto, G. S., Dy, R., Hunter, D., Calvo, B., Dawson, T. L., Wilm, M., Anderegg, R. J., Graves, L. M. et al. (1996). Activation of a novel calcium-dependent protein-tyrosine kinase. Correlation with c-Jun N-terminal kinase but not mitogen-activated protein kinase activation. J. Biol. Chem. 271, 29993-29998.
Zheng, C., Xing, Z., Bian, Z. C., Guo, C., Akbay, A., Warner, L. and Guan, J. L. (1998). Differential regulation of Pyk2 and focal adhesion kinase (FAK). The C-terminal domain of FAK confers response to cell adhesion. J. Biol. Chem. 273, 2384-2389.
Zwick, E., Wallasch, C., Daub, H. and Ullrich, A. (1999). Distinct calcium-dependent pathways of epidermal growth factor receptor transactivation and PYK2 tyrosine phosphorylation in PC12 cells. J. Biol. Chem. 274, 20989-20996.
| ||||||