|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online March 22, 2006
doi: 10.1242/10.1242/jcs.02852
Research Article |
1 Department of Neuroscience, `Dino Ferrari' Centre, University of Milan-IRCCS Istituto Auxologico Italiano, Via Zucchi 18, 20095 Cusano Milanino, Italy
2 Department of Experimental and Applied Pharmacology, University of Pavia, Via Taramelli 14, 27100 Pavia, Italy
3 Laboratory of Metabolomics and Systems Biology, Magnetic Resonance Center and FiorGen Foundation, University of Florence, Via Sacconi 6, 50019 Sesto Fiorentino, Italy
* Author for correspondence (e-mail: antonia.ratti{at}unimi.it)
Accepted 21 December 2005
| Summary |
|---|
|
|
|---|
Key words: ELAV, Musashi-1, Neurogenesis, RNA-binding protein, Stem cell
| Introduction |
|---|
|
|
|---|
The Musashi-1 (Msi1) RBP was first reported to be required for the proper development of the neural sensory organ in Drosophila (Nakamura et al., 1994
), whereas in mammals it is commonly considered a specific marker for stem/progenitor cells of neural origin (Kaneko et al., 2000
; Maslov et al., 2004
). Msi1 acts as a translational suppressor by binding to the 3'-untranslated region (3'UTR) of specific mRNA targets. In this way the proliferation state of NSCs is maintained by inhibiting the translation of the membrane protein Numb, involved in the Notch/Delta signaling cascade (Imai et al., 2001
), and of the cyclin-dependent kinase inhibitor p21WAF-1 (Battelli et al., 2006
).
The neuronal-specific ELAV (nELAV) RBPs, which are associated with the pathological condition of paraneoplastic encephalomyelitis (Szabo et al., 1991
), are necessary and sufficient to induce neuronal differentiation in mammalian cells (Akamatsu et al., 1999
; Kasashima et al., 1999
), as is their elav ortholog in Drosophila (Robinow and White, 1991
). The three mammalian nELAV family members, HuB, HuC and HuD, are commonly referred to as early and specific markers of post-mitotic neurons during CNS development (Barami et al., 1995
; Okano and Darnell, 1997
; Wakamatsu and Weston, 1997
), whereas the fourth member, HuR, is ubiquitously expressed. The ELAV RNA-binding activity promotes the stabilization and/or translation of an array of transcripts containing the AU-rich consensus element (ARE) in their 3'UTR (Antic and Keene, 1997
). ARE sequences represent well-documented cis-acting regulatory motifs usually identified in mRNAs of genes with a high turnover rate (Shaw and Kamen, 1986
), and are recognized by several ARE-binding proteins which exert a different and often opposite role on mRNA fate (Bevilacqua et al., 2003
). nELAV target genes are endowed with a wide variety of biological functions (Gao et al., 1994
), from cell growth regulation (Levine et al., 1993
) to brain maturation and maintenance (Antic et al., 1999
; Aranda-Abreu et al., 1999
; Chung et al., 1997
).
The expression of Msi1 and nELAV RBPs has been initially described to be spatiotemporally sequential during the development of murine CNS (Sakakibara et al., 1996
), although recent data suggest that nELAV proteins might have an important role as early as the neuronal-specific commitment of NSCs (Akamatsu et al., 2005
).
In the present work we show that nELAV proteins are expressed and colocalize with Msi1 in the adult mouse SVZ and in cultured NSCs/progenitors, where they show a specific and ARE-dependent binding activity for the Msi1 transcript. In particular, we find that nELAV RBPs exert a stabilizing activity on Msi1 mRNA decreasing its turnover rate in vitro and promoting its translation in vivo. Such findings suggest a mechanistic correlation between nELAV and Msi1 RBPs in controlling the proliferation/differentiation activities of neural stem/progenitor cells.
| Results |
|---|
|
|
|---|
|
These preliminary findings prompted us to investigate the possible role of the nELAV RBPs as trans-acting factors in the binding and regulation of the Msi1 transcript. To this purpose after UV crosslinking assays, the resulting mRNP complexes were immunoprecipitated with the pan anti-nELAV antibody (16A11), which is known to recognize the three neuronal RBPs HuB, HuC and HuD, but not HuR (Marusich et al., 1994
) (Fig. 1D). A 42 kDa complex was immunoprecipitated in the presence of the Msi1 3'UTR riboprobe, confirming the existence of an nELAV RNA-binding activity for the Msi1 transcript both in mature brain and in NSCs.
As several RBPs are reported to bind to their own mRNA (Chu et al., 1991
; Schaeffer et al., 2001
), including nELAV proteins (Abe et al., 1996
; Samson, 1998
), we also immunoprecipitated the products of the UV crosslinking reaction using the anti-Msi1 antibody, but the Msi1 transcript was not recovered (Fig. 1E).
nELAV proteins are expressed in neural stem/progenitor cells in vitro
Our preliminary data suggest the existence of a functional correlation between the Msi1 gene, associated with the maintenance of NSC proliferation, and the nELAV RBPs, usually considered early markers of newly generated neurons. NSCs isolated from developing or mature brain can be grown in vitro as floating cell aggregates denominated neurospheres, which are characterized by an indefinite proliferation potentiality and by the multipotency to differentiate into the principal neural phenotypes (Morshead and van der Kooy, 2004
). We therefore looked for nELAV protein expression in neurospheres obtained from adult mouse brains. Immunolabeling images with the anti-Msi1 antibody showed colocalization with the nELAV antigens throughout the sphere (Fig. 2A-C), suggesting a stem identity of nELAV-positive cells. To further characterize the expression of these RBPs, from tridimensional neurospheres we obtained a monolayer of stem/progenitor cells after dissociation and exposure to adhesive substrate for 1 hour. This limited period of time allows the preservation of the typical NSC heterogeneous morphologies and it is not sufficient to commit cells towards a specific fate (Bez et al., 2003
; Suslov et al., 2002
). As in neurosphere cultures, double fluorescent signals for nELAV and Msi1 were still present although their cellular distribution appeared slightly different, Msi1 signals being prevalent in the nuclei and nELAV RBP signals more diffuse in the cytoplasm (Fig. 2D-F). Coexpression of the intermediate filament nestin, widely used as a neural stem/progenitor cell marker (Wiese et al., 2004
), with both nELAV and Msi1 demonstrated the still undifferentiated and proliferating state of our neurosphere-derived cell culture (data not shown). The specificity of the anti-Msi1 antibody used was previously verified in committed progenitor cells with neuronal morphology, which resulted positive for the differentiation marker ß-tubulinIII and negative for Msi1, and in immature astrocytes, positive for both GFAP and Msi1 (Sakakibara et al., 1996
) (data not shown).
|
Furthermore, the uncommitted mitotic state of the neurosphere-derived cells was attested by the positive labeling for the proliferation-associated antigen Ki67, a protein produced in all active phases of the cell cycle, but absent in G0 (Kee et al., 2002
). nELAV RBPs and Ki67 were co-expressed in actively proliferating cells with a distinct cellular distribution, nuclear for Ki67 and mainly cytoplasmic for nELAV proteins (Fig. 2G-I). nELAV protein staining was also present in non-proliferating Ki67-negative cells.
nELAV RBPs are expressed in the neurogenic SVZ in vivo
Since our immunostaining data clearly indicate that nELAV proteins are not limited to early post-mitotic and mature neurons, we wanted to investigate nELAV expression in vivo in the SVZ region, one of the germinal areas where neurogenesis occurs in the adult. Brain sections from adult rats were immunolabeled with anti-nELAV and anti-Ki67 antibodies (Fig. 3A,B): nELAV proteins were clearly expressed in the SVZ and overlapped the Ki67 fluorescent signals with a complementary intracellular distribution pattern (Fig. 3C,D). As neuronal-specific markers, nELAV proteins were also strongly expressed in the cerebral areas surrounding the lateral ventricle, where Ki67 labeling was absent. Immunostaining with the anti-Msi1 antibody confirmed the presence of stem/progenitor cells in the SVZ. The concomitant expression of Msi1 and nELAV proteins in this neurogenic region (Fig. 3E-G), mainly confined to the sub-ependymal cell layer (Fig. 3H), suggests the importance of both these RBPS in regulating NSC proliferation.
|
The Msi1 mRNA is a target of the nELAV proteins in neurospheres
We have found that nELAV proteins are endowed with an RNA-binding activity for the Msi1 transcript and are expressed in neural stem/progenitor cells in vitro and in vivo. A ribonomic approach (Tenenbaum et al., 2002
) was then used to isolate nELAV-containing mRNP complexes from adult mouse neurospheres. Endogenous mRNPs were immunoprecipitated from neurosphere lysates with anti-nELAV, with an irrelevant isotype-matched antibody (anti-His5) and with no antibody, respectively, in three independent experiments. Precipitated mRNAs from each sample were subjected to quantitative real-time RT-PCR using specific sets of primers for Msi1, Rpl10a, Gap43 and Mapt (microtubule-associated protein tau) genes. The housekeeping Rpl10a, encoding a ribosomal large subunit protein, was used as negative control because it does not contain an ARE consensus sequence in its 3'UTR. Gap43 and Mapt are two well-known mRNA targets of nELAV RBPs both in developing and mature neurons. In the nELAV-containing mRNP complexes, Msi1 mRNA was enriched 62-fold compared with the control sample (anti-His5) (Fig. 4), whereas Rpl10a was absent in all the experimental conditions tested, although its content in the input lysate was 100-fold more abundant than Msi1 (see Table S1 in supplementary material). Neither Gap43 nor Mapt transcripts were significantly immunoprecipitated from neurospheres by the anti-nELAV antibody, even if these two genes were expressed in the input lysate and were recovered from mRNPs of mouse mature brain (data not shown).
|
The HuD protein shows an ARE-dependent binding activity for the Msi1 3'UTR
We then tested whether nELAV protein binding to Msi1 mRNA was dependent on the presence of the putative ARE consensus sequence. Two deletion transcripts, ARE+ and ARE-, were obtained from the mouse Msi1 3'UTR sequence analysis. UV-crosslinking assays on neurosphere lysates revealed that the ARE+ probe showed the same RBP-binding pattern as the full-length Msi1 3'UTR, whereas all RNA-protein interactions were abolished when the ARE- fragment was used (Fig. 5B, left panel). This finding suggests that the presence of RBPs or associated proteins in the Msi1-containing mRNP complexes is strictly dependent on the cis-acting regulatory sequence of the ARE region. We have demonstrated that nELAV proteins exhibit an RNA-binding activity for the Msi1 transcript both in in vitro and in vivo immunoprecipitation assays. In order to further characterize this binding affinity, we expressed a recombinant His-tagged HuD protein and performed UV-crosslinking experiments. RNA-protein complexes formed with the Msi1 full-length 3'UTR and ARE+, but not with the ARE- riboprobe, confirming a strictly ARE-dependent binding activity of the HuD protein (Fig. 5B, right panel). To demonstrate the specificity of such in vitro binding, competition assays were performed using a 100x molar excess of ARE+ and ARE- riboprobes together with Msi1 full-length 3'UTR (Fig. 5C, left and right panels). Although ARE- had no ability to bind to HuD, cold ARE+ and Msi1 3'UTR efficiently competed with the radiolabeled probe. The HuD-specific binding to Msi1 ARE sequence was also confirmed by the absence of interaction with an irrelevant sequence (As). The binding was dose dependent, as shown by UV-crosslinking assays performed with increasing amounts of recombinant HuD protein (Fig. 5D).
|
HuD acts on the Msi1 mRNA by reducing its degradation rate
ARE sequence elements are usually present in mRNAs with a high turnover rate (Chen and Shyu, 1995
), on which they determine increased or decreased stability, probably depending on the bound RBPs (Lal et al., 2004
). We wanted to investigate whether the presence of the HuD-bound ARE in the Msi1 gene was associated to a cis-acting regulatory role. To this end, the stability profile of the Msi1 mRNA was studied by means of a functional approach which allowed us to reproduce and follow the mRNA deadenylation/degradation kinetic profile in vitro (Ford et al., 1999
). For this assay short capped and polyadenylated (polyA60) transcripts were synthesized to represent the putative functional region of the Msi1 3'UTR. We produced a 114 bp 32P-labeled fragment containing the ARE consensus site (µmsi1ARE+) and an irrelevant 148 bp transcript as a control (µmsi1AS, the antisense sequence of the ARE- fragment). The deadenylation kinetic and the associated degradation of the body of these two synthetic mRNAs, composed only of putative regulatory sequences, were followed by simply visualizing their decrease in length on a denaturing gel. We observed that the deadenylation of the µmsi1ARE+ transcript was progressive and became complete within 30 minutes compared with the fully deadenylated probe (A0), used as a reference marker (Fig. 6A). By contrast, high-molecular-weight intermediates of the µmsi1AS probe (i.e. smear length and consistence) were still present after a longer incubation time (45 minutes), indicating a slower degradation kinetic rate.
|
When the same deadenylation/degradation assay was repeated in the presence of the recombinant HuD protein, the decay rate of the µmsi1ARE+ transcript markedly decreased compared with the control, and resembled that of the µmsi1AS mRNA in the degradation profile (Fig. 6B). Indeed, after a 45-minute incubation, the shortening of the polyA60 tail was still incomplete compared with the same sample incubated in the absence of HuD, with the persistence of high-molecular-weight species corresponding to the almost intact transcript. When the µmsi1AS mRNA was used, the addition of the recombinant HuD protein did not alter the deadenylation pattern (data not shown). These results demonstrate that the conserved AU-rich region in the Msi1 3'UTR acts as a cis-acting regulatory sequence on which the nELAV HuD protein specifically exerts its stabilizing activity by decreasing its mRNA turnover rate.
The PKC
-dependent activation of the nELAV RBPs upregulates Msi1 translation in the cytoskeleton
We have recently shown that the nELAV proteins undergo translocation from the cytosolic to the cytoskeletal compartment after treatment with phorbol esters (PMA) in human neuroblastoma SH-SY5Y cells (Pascale et al., 2005
). Such translocation is accompanied by nELAV RBP threonine phosphorylation as a consequence of PKC
isozyme activation. A PKC
-dependent stabilization of the Gap43 mRNA and an increase in its protein levels were also specifically observed in the cytoskeleton. We investigated the effect of nELAV protein activation on Msi1 content in the same cell model after treatment with PMA or solvent alone (DMSO). Msi1 protein levels were examined on cellular fractions by western blotting (Fig. 7A). PKC
translocation to the cytoskeletal compartment was clearly evident (+63%, P<0.05), together with nELAV protein increase (+98%, P<0.001), reproducing the nELAV RBP activation process already described. We also found that the Msi1 protein content significantly increased in the cytoskeleton (+107%, P<0.001) after nELAV RBP activation by phorbol ester treatment.
|
| Discussion |
|---|
|
|
|---|
From our work we have an indirect evidence that nELAV activity could be developmentally regulated, because by selectively immunoprecipitating nELAV-containing mRNP complexes from adult neurospheres we were unable to show any binding to two well-known mRNA targets, Gap43 and Mapt, which nonetheless are expressed in proliferating neurospheres (Esdar et al., 1999
). Therefore, nELAV binding to ARE-bearing mRNAs could depend on various factors like nELAV activation and phosphorylation state (Pascale et al., 2005
), and on the interaction or competition with other RBPs in a cell-state and cell-compartment specific manner.
Immunoprecipitation of neurosphere mRNPs and in vitro binding experiments with the recombinant HuD protein clearly demonstrated that nELAV proteins are able to recognize the Msi1 transcript in an ARE-specific and ARE-dependent way. We looked for a functional meaning of this association by the approach described by Ford and Wilusz (Ford and Wilusz, 1999
), a highly reproducible system that mimics the whole mRNA catabolism in vitro. Results obtained by this deadenylation and degradation assay showed that the basal decay pattern of a synthetic mRNA bearing the Msi1 ARE sequence was faster than in its absence, and that addition of the recombinant HuD protein stabilized this transcript, as similarly described for HuB and TNF-
(Ford et al., 1999
). Therefore, the HuD activity on the Msi1 transcript suggests a positive effect on its translation, as already described for other nELAV target genes (Antic et al., 1999
; Mazan-Mamczarz et al., 2003
). Our functional data on neuroblastoma cells showed that phorbol-ester-induced stimulation of diacylglycerol-dependent PKC isozymes determines an increase of PKC
and nELAV protein content in the cytoskeleton. This effect, previously described to be associated with PKC
and nELAV protein colocalization and with an increase in the threonine phosphorylation state of nELAV RBPs (Pascale et al., 2005
), probably reflects an induction of nELAV activity at the polysomal level (A.Q., unpublished results). We showed that these phenomena were also associated with an increase in the Msi1 protein content, which was evident especially in the cytoskeletal compartment, as already shown for the nELAV protein target GAP-43.
|
Neurogenesis is a multi-step cell process that gradually leads a self-renewing undifferentiated NSC to acquire a completely differentiated phenotype. During embryogenesis this is achieved through symmetric division of the initial NSC, which increases the body mass as a first step. Progenitors, slightly differentiated and committed cells, originate from NSCs by sequential asymmetric division and, although for a limited number of cell cycles, they maintain the proliferative capacity. Therefore the cell programs of proliferation and differentiation are both active in progenitors, and need to be finely co-regulated. A molecular pathway known to be essential for the maintenance of actively proliferating NSCs is the Notch/Delta cascade, which controls cell division and neural differentiation (Hitoshi et al., 2002
). The Msi1 protein contributes to the Notch-mediated proliferation of NSCs by binding and preventing the translation of Numb (Imai et al., 2001
), which is known to negatively affect Notch activation (Cayouette and Raff, 2002
; Zhong et al., 1996
). On the other hand, the nELAV proteins have been widely demonstrated to be necessary and sufficient to induce neuronal differentiation in vitro. The exact timing and cascade of events that cause an NSC to completely exit from the cell cycle is hard to define, but the process is accompanied by the inactivation of cyclin-dependent kinases by specific inhibitors, such as p21WAF-1. Interestingly, its mRNA was shown to be regulated positively by HuD (Joseph et al., 1998
) which competes with hnRNP K for the same 3'UTR motif (Yano et al., 2005
), and negatively by Msi1 whose binding to an adjacent site blocks p21WAF-1 translation (Battelli et al., 2006
). According to our results, we propose that the HuD-mediated stabilization of Msi1 mRNA may serve to prolong Msi1 activity in the proliferating neural progenitor cell which is going to exit the cell cycle (Fig. 8). This would allow the stem/progenitor cell to continue to divide even after Msi1 transcriptional inactivation.
The post-transcriptional regulative mechanism of nELAV proteins on Msi1 mRNA seems to be evolutionarily restricted to mammals from embryonic to adult neurogenesis. Regenerative events in the SVZ have already been demonstrated to occur in vivo in the adult CNS after an ischemic insult or a damage (Douen et al., 2004
; Yagita et al., 2002
), whereas in the hippocampus, neurogenesis has been strictly linked to the processes of learning, neuronal plasticity and memory formation (Kempermann et al., 2004
; Schinder and Gage, 2004
). Upregulation and cytoskeletal translocation of nELAV proteins and the subsequent positive effects on Gap43 mRNA levels have been recently described in tight association with synaptic plasticity and learning processes in rat dentate gyrus (Bolognani et al., 2004
; Pascale et al., 2004
; Quattrone et al., 2001
). We speculate that our findings of a positive nELAV modulation of Msi1 transcript and protein level could be required for the transition from proliferation to differentiation of the stem/progenitor cells residing in the hippocampal subgranular zone, as well as in the SVZ. In adult neurogenic areas, nELAV activity could be assumed to be transiently induced by signals present only in restricted spatial and/or temporal conditions. We have recently demonstrated that nELAV proteins are activated by a PKC
-dependent pathway in human neuroblastoma cells (Pascale et al., 2005
), and it is known that PKC-dependent signal transduction is at the basis of many aspects of CNS development (Metzger and Kapfhammer, 2003
). The combination of these observations with the present results could open the possibility of a pharmacological modulation of NSC dynamics.
In conclusion, our results suggest that in mammals nELAV proteins may have a key biological role in positively regulating Msi1 gene expression along a molecular cascade leading a proliferating stem cell towards a multi-step neural differentiation process. Since the intrinsic features of NSCs make them attractive candidates for cell-based repair therapy of the CNS (Cova et al., 2004
; Lakshmipathy and Verfaillie, 2005
), the nELAV/Msi1 pathway could also represent a new pharmacological target for enhancement of neurogenesis in the treatment of neurodegenerative disorders.
| Materials and Methods |
|---|
|
|
|---|
Human neuroblastoma SH-SY5Y cells were grown in MEM (Eagle's minimal essential medium) with 10% fetal calf serum, penicillin/streptomycin, non-essential amino acids and 1 mM sodium pyruvate (Invitrogen). Cells were exposed to 100 nM phorbol 12-myristate-13-acetate (PMA, Sigma) or to the solvent alone (DMSO) for 15 minutes and then the incubation was stopped with ice-cold PBS.
Protein extracts, cell fractioning and western blot
Total mouse brain and NSC cultures were homogenized in lysis buffer (150 mM NaCl, 20 mM Tris-HCl, 1% Triton X-100, protease inhibitor cocktail; Roche) and 400 U/ml RNase inhibitor (Promega). Samples were centrifuged at 12,000 g for 20 minutes at 4°C and supernatant was collected. Proteins from different cell fractions were obtained as previously published with slight modifications (Pascale et al., 1996
). Briefly, SH-SY5Y cells were homogenized in buffer A (20 mM Tris-HCl pH 7.4, 2 mM EDTA, 0.5 mM EGTA, 50 mM mercaptoethanol, 0.32 mM sucrose and protease inhibitor cocktail) and centrifuged at 100,000 g for 1 hour. The supernatant containing the cytosolic fraction was collected. The pellet was resuspended in the same buffer containing 1% Triton X-100, sonicated, and incubated for 45 minutes at 4°C, then centrifuged again at 100,000 g for 1 hour. The supernatant containing the membrane fraction and the pellet with the cytoskeletal component were collected. Proteins were resolved by SDS-PAGE, transferred to nitrocellulose membranes and immunoblotted with Msi1 (1:200, Chemicon), PKC
(1:1000, Transduction Laboratories),
-tubulin (1:5000, Santa Cruz Biotechnology) antibodies, and Hu-positive serum (1:1000).
Plasmid constructs
Total RNA was extracted from whole mouse brain with TriZol® reagent (Invitrogen) and used to amplify Msi1 and Gap43 3'UTR sequences by RT-PCR with the following primers: Msi1_fw TGAGGACCAGACTGAGCCAGCAAG and Msi1_rev GGGGCCTCAGTCTGCAGCAG; GAP-43_fw ATGCCTGAACTTTAAGAAATGGCT and GAP-43_rev ATGAGGAAACAAAATGGTTTTTG. The products were cloned into pGem®-T Easy Vector (Promega). ARE+ and ARE- fragments were obtained by PCR amplification of the above Msi1-pGem® construct with the following primers: Msi1_fw and ARE+_rev GTAGGGCAACTGGCTAATC; ARE-_fw GATTAGCCAGTTGCCCTAC and Msi1_rev. The µmsi1ARE+ insert was subcloned from the Msi1-pGem® construct (primers: CTCATGTCTGGCTCCCCTACT and GTAGGGCAACTGGCTAATC) into the pCR®II-TOPO® (Invitrogen) vector and selected in order to have the T7 promoter at the 5' end and the HindIII restriction site at the 3' end of the cloning site for the mRNA decay assay. The cDNA fragment encoding the open-reading frame for HuD (GenBank accession number D31953) was amplified by RT-PCR using the following modified primers: HuD_fw TGATCTCATGAAGCCTCAGGTGTCAAATGGAC and HuD_rev CTGCATCCCGGGGGATTTGTGGGCTTTGTTGGTT. The product was digested with RcaI/SmaI and directionally cloned into the expression vector pIVEX2.3d (Roche) with a His tag at the C-terminus. All the clones and their orientation were validated by sequencing.
RNA labeling
Radiolabeled riboprobes were obtained by transcribing 0.5 µg linearized construct DNA with 20 U T7 RNA polymerase (Roche), 20 µCi [
-32P]UTP, 0.5 mM NTPs, 20 U RNase inhibitor (Promega) for 30 minutes at 37°C. The reaction was stopped at 65°C and template DNA was removed by DNaseI digestion (20 U, Roche). The resulting 32P-labeled riboprobe was purified on ProbeQuant G-50 microcolumns (Amersham Biosciences).
In vitro Translation
Recombinant HuD protein was obtained in a cell-free system in which 0.5 µg HuD-pIVEX2.3d plasmid was incubated at 30°C for 6 hours in the reaction solution, containing E. coli lysate and amino acids according to the manufacturer's instructions (Roche). The fusion protein was purified on Ni-NTA spin kit columns and visualized by western blotting using an Anti-His5 antibody (Qiagen).
UV crosslinking and immunoprecipitation
300,000 cpm of 32P-labeled RNA transcripts were incubated with 40 µg of protein extract or with 300 ng of recombinant HuD protein in 15 µl ligation buffer (1.3 mM MgCl2, 19 mM HEPES-KOH pH 7.4, 1.5 mM ATP, 19 mM creatine phosphate) for 10 minutes at 30°C. After addition of 5 µg tRNA, samples were irradiated with UV (Stratalinker®, Stratagene) for 5 minutes on ice and RNaseA treated (25 U) for 30 minutes. Samples were run on a 12% SDS-PAGE, and analyzed by autoradiography. For competition experiments, a 100x molar excess of cold riboprobe was added to the sample before UV irradiation. Immunoprecipitation was conducted on UV crosslinked samples by the addition of 4 µg of the selected antibody for 2 hours at 4°C. Samples were then incubated with 30 µl Protein A/G Sepharose beads (Amersham Biosciences) for 2 hours at 4°C. Immunocomplexes were then collected by centrifugation at 14,000 g for 30 seconds, washed several times in lysis buffer, run on a 12% SDS-PAGE and analyzed by autoradiography.
Immunocytochemistry and immunohistochemistry
Cells were fixed with 4% paraformaldehyde in PBS (pH 7.4) for 20 minutes, blocked with 10% normal goat serum (NGS) and permeabilized with 0.3% Triton X-100 (Gritti et al., 1999
). 20-µm-thick coronal brain sections from adult rats intracardially perfused with 4% paraformaldehyde were mounted on glasses pre-coated with poly-L-lysine. Sections were boiled for 15 minutes in 50 mM Tris-HCl (pH 8.0), permeabilized with 0.5% Triton X-100 and blocked with 10% NGS. Samples were exposed to the selected antibodies overnight at 4°C (antibodies and dilutions used are specified in Table S2 in supplementary material). Slides were mounted with FluorsaveTM (Calbiochem) and acquired with a camera connected to a DMIRE2/HCS microscope (Leica Microsystems). For negative controls, the primary antibody was replaced with NGS.
Isolation and immunoprecipitation of mRNP complexes
About 5x106 NSCs were harvested for each condition, washed several times with cold PBS and resuspended in 1:1 (v/v) RNP buffer (100 mM KCl, 5 mM MgCl2, 10 mM HEPES pH 7.4, 0.5% NP-40) (Tenenbaum et al., 2002
). 50 µl protein A/G Sepharose beads, pre-coated with 8 µg of the selected antibody, were added to 300 µg NSC lysate in 1 ml NT2 buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM MgCl2, 0.05% NP-40), containing 400 U RNase inhibitor, 1 M DTT and 20 mM EDTA. 10% of the reaction mix was collected as the initial input and RNA was extracted by TriZol® reagent (Invitrogen). After a 2-hour incubation, the immunoprecipitated mRNPs were washed several times with cold NT2 buffer, incubated with 30 µg of proteinase K for 30 minutes and phenol-chloroform extracted. After DNaseI digestion, the isolated mRNAs were retro-transcribed using SuperScriptII RT (Invitrogen), oligo dT and random primers.
Real-time quantitative PCR
Real-time PCR was performed for 45 cycles with SYBRGreen PCR Master mix (Applied Biosystems) and processed on the ABI Prism 7900HT sequence detection system. Oligonucleotide pairs for each gene were designed with Primer Express 2.0 software (Applied Biosystems) on exon boundaries. Reactions were conducted in triplicate for each sample and a dissociation curve was produced at the end. For the mRNP assays, the threshold cycle (Ct) values of immunoprecipitated samples were normalized to the Ct value of the corresponding input (
Ct) to account for differences in initial mRNA quantities. 
Ct was calculated by subtracting the
Ct value of the sample with no antibody to the
Ct of the sample with anti-nELAV or anti-His5 antibodies and fold differences were then expressed as 2-
Ct (Chakrabarti et al., 2002
). Statistical analysis was conducted by one-way ANOVA with Bonferroni t-test correction. For primer sequences and real-time PCR data see Tables S1 and S3 in supplementary material.
In vitro mRNA degradation/deadenylation assay
The mRNA decay experiments were conducted as described (Ford and Wilusz, 1999
) with some modifications. Whole-brain cytoplasmic extracts were used to reproduce a neural-like environment in vitro. The addition of the polyA60 tail to the µmsi1ARE+ or µmsi1AS constructs was carried out by the PCR-ligation procedure. Briefly, the double-stranded linker AGCTT(A)60TATTTACCTCGAGCACTC was ligated to the HindIII-digested plasmids, which were then amplified with the T7 promoter primer and the complementary linker primer (GAGTGCTCGAGGTAAATAT). Products were digested with SspI and in-vitro transcribed in the presence of 7mGpppG (Roche) and [
-32P]UTP. Riboprobes were run on a denaturing 5% polyacrylamide gel (19:1) containing 8 M urea. After a short autoradiographic exposure, bands were excized from the gel, eluted overnight in HSCB buffer (400 mM NaCl, 25 mM Tris-HCl pH 7.6, 0.1% SDS), phenol-chloroform extracted and ethanol precipitated. 200,000 cpm riboprobes were incubated with 200 µg of mouse brain extract and 0.5 µg polyA (Amersham Biosciences) in 15 µl deadenylation buffer (2.6% polyvinyl alcohol, 1 mM ATP, 13 mM creatine phosphate) at 30°C. At the indicated time intervals reactions were stopped with 400 µl HSCB buffer. RNA was extracted in phenol-chloroform, separated on an urea-denatured 5% polyacrylamide gel and visualized by autoradiography.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Abe, R., Sakashita, E., Yamamoto, K. and Sakamoto, H. (1996). Two different RNA binding activities for the AU-rich element and the poly(A) sequence of the mouse neuronal protein mHuC. Nucleic Acids Res. 24, 4895-4901.
Akamatsu, W., Okano, H. J., Osumi, N., Inoue, T., Nakamura, S., Sakakibara, S., Miura, M., Matsuo, N., Darnell, R. B. and Okano, H. (1999). Mammalian ELAV-like neuronal RNA-binding proteins HuB and HuC promote neuronal development in both the central and the peripheral nervous systems. Proc. Natl. Acad. Sci. USA 96, 9885-9890.
Akamatsu, W., Fujihara, H., Mitsuhashi, T., Yano, M., Shibata, S., Hayakawa, Y., Okano, H. J., Sakakibara, S., Takano, H., Takano, T. et al. (2005). The RNA-binding protein HuD regulates neuronal cell identity and maturation. Proc. Natl. Acad. Sci. USA 102, 4625-4630.
Alvarez-Buylla, A. and Garcia-Verdugo, J. M. (2002). Neurogenesis in adult subventricular zone. J. Neurosci. 22, 629-634.
Antic, D. and Keene, J. D. (1997). Embryonic lethal abnormal visual RNA-binding proteins involved in growth, differentiation, and posttranscriptional gene expression. Am. J. Hum. Genet. 61, 273-278.[Medline]
Antic, D., Lu, N. and Keene, J. D. (1999). ELAV tumor antigen, Hel-N1, increases translation of neurofilament M mRNA and induces formation of neurites in human teratocarcinoma cells. Genes Dev. 13, 449-461.
Aranda-Abreu, G. E., Behar, L., Chung, S., Furneaux, H. and Ginzburg, I. (1999). Embryonic lethal abnormal vision-like RNA-binding proteins regulate neurite outgrowth and tau expression in PC12 cells. J. Neurosci. 19, 6907-6917.
Asson-Batres, M. A., Spurgeon, S. L., Diaz, J., DeLoughery, T. G. and Bagby, G. C., Jr (1994). Evolutionary conservation of the AU-rich 3' untranslated region of messenger RNA. Proc. Natl. Acad. Sci. USA 91, 1318-1322.
Bakheet, T., Frevel, M., Williams, B. R., Greer, W. and Khabar, K. S. (2001). ARED: human AU-rich element-containing mRNA database reveals an unexpectedly diverse functional repertoire of encoded proteins. Nucleic Acids Res. 29, 246-254.
Barami, K., Iversen, K., Furneaux, H. and Goldman, S. A. (1995). Hu protein as an early marker of neuronal phenotypic differentiation by subependymal zone cells of the adult songbird forebrain. J. Neurobiol. 28, 82-101.[CrossRef][Medline]
Battelli, C., Nikopoulos, G. N., Mitchell, J. G. and Verdi, J. M. (2006). The RNA-binding protein Musashi-1 regulates neural development through the translational repression of p21(WAF-1). Mol. Cell Neurosci. 31, 85-96.[CrossRef][Medline]
Bevilacqua, A., Ceriani, M. C., Capaccioli, S. and Nicolin, A. (2003). Post-transcriptional regulation of gene expression by degradation of messenger RNAs. J. Cell. Physiol. 195, 356-372.[CrossRef][Medline]
Bez, A., Corsini, E., Curti, D., Biggiogera, M., Colombo, A., Nicosia, R. F., Pagano, S. F. and Parati, E. A. (2003). Neurosphere and neurosphere-forming cells: morphological and ultrastructural characterization. Brain Res. 993, 18-29.[CrossRef][Medline]
Bolognani, F., Merhege, M. A., Twiss, J. and Perrone-Bizzozero, N. I. (2004). Dendritic localization of the RNA-binding protein HuD in hippocampal neurons: association with polysomes and upregulation during contextual learning. Neurosci. Lett. 371, 152-157.[CrossRef][Medline]
Bottai, D., Fiocco, R., Gelain, F., Defilippis, L., Galli, R., Gritti, A. and Vescovi, L. A. (2003). Neural stem cells in the adult nervous system. J. Hematother. Stem Cell Res. 12, 655-670.[CrossRef][Medline]
Briata, P., Ilengo, C., Corte, G., Moroni, C., Rosenfeld, M. G., Chen, C. Y. and Gherzi, R. (2003). The Wnt/beta-catenin->Pitx2 pathway controls the turnover of Pitx2 and other unstable mRNAs. Mol. Cell 12, 1201-1211.[CrossRef][Medline]
Cayouette, M. and Raff, M. (2002). Asymmetric segregation of Numb: a mechanism for neural specification from Drosophila to mammals. Nat. Neurosci. 5, 1265-1269.[CrossRef][Medline]
Chakrabarti, S. K., James, J. C. and Mirmira, R. G. (2002). Quantitative assessment of gene targeting in vitro and in vivo by the pancreatic transcription factor, Pdx1. Importance of chromatin structure in directing promoter binding. J. Biol. Chem. 277, 13286-13293.
Chen, C. Y. and Shyu, A. B. (1995). AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. Sci. 20, 465-470.[CrossRef][Medline]
Chu, E., Koeller, D. M., Casey, J. L., Drake, J. C., Chabner, B. A., Elwood, P. C., Zinn, S. and Allegra, C. J. (1991). Autoregulation of human thymidylate synthase messenger RNA translation by thymidylate synthase. Proc. Natl. Acad. Sci. USA 88, 8977-8981.
Chung, S., Eckrich, M., Perrone-Bizzozero, N., Kohn, D. T. and Furneaux, H. (1997). The Elav-like proteins bind to a conserved regulatory element in the 3'-untranslated region of GAP-43 mRNA. J. Biol. Chem. 272, 6593-6598.
Cova, L., Ratti, A., Volta, M., Fogh, I., Cardin, V., Corbo, M. and Silani, V. (2004). Stem cell therapy for neurodegenerative diseases: the issue of transdifferentiation. Stem Cells Dev. 13, 121-131.[CrossRef][Medline]
Cuadrado, A., Garcia-Fernandez, L. F., Imai, T., Okano, H. and Munoz, A. (2002). Regulation of tau RNA maturation by thyroid hormone is mediated by the neural RNA-binding protein musashi-1. Mol. Cell. Neurosci. 20, 198-210.[CrossRef][Medline]
Cuadrado, A., Navarro-Yubero, C., Furneaux, H. and Munoz, A. (2003). Neuronal HuD gene encoding a mRNA stability regulator is transcriptionally repressed by thyroid hormone. J. Neurochem. 86, 763-773.[CrossRef][Medline]
Ding, Y., Chan, C. Y. and Lawrence, C. E. (2004). Sfold web server for statistical folding and rational design of nucleic acids. Nucleic Acids Res. 32, W135-W141.
Douen, A. G., Dong, L., Vanance, S., Munger, R., Hogan, M. J., Thompson, C. S. and Hakim, A. M. (2004). Regulation of nestin expression after cortical ablation in adult rat brain. Brain Res. 1008, 139-146.[CrossRef][Medline]
Esdar, C., Oehrlein, S. A., Reinhardt, S., Maelicke, A. and Herget, T. (1999). The protein kinase C (PKC) substrate GAP-43 is already expressed in neural precursor cells, colocalizes with PKCeta and binds calmodulin. Eur. J. Neurosci. 11, 503-516.[CrossRef][Medline]
Ford, L. P. and Wilusz, J. (1999). An in vitro system using HeLa cytoplasmic extracts that reproduces regulated mRNA stability. Methods 17, 21-27.[CrossRef][Medline]
Ford, L. P., Watson, J., Keene, J. D. and Wilusz, J. (1999). ELAV proteins stabilize deadenylated intermediates in a novel in vitro mRNA deadenylation/degradation system. Genes Dev. 13, 188-201.
Galli, R., Gritti, A., Bonfanti, L. and Vescovi, A. L. (2003). Neural stem cells: an overview. Circ. Res. 92, 598-608.
Gao, F. B., Carson, C. C., Levine, T. and Keene, J. D. (1994). Selection of a subset of mRNAs from combinatorial 3' untranslated region libraries using neuronal RNA-binding protein Hel-N1. Proc. Natl. Acad. Sci. USA 91, 11207-11211.
Gritti, A., Frolichsthal-Schoeller, P., Galli, R., Parati, E. A., Cova, L., Pagano, S. F., Bjornson, C. R. and Vescovi, A. L. (1999). Epidermal and fibroblast growth factors behave as mitogenic regulators for a single multipotent stem cell-like population from the subventricular region of the adult mouse forebrain. J. Neurosci. 19, 3287-3297.
Hitoshi, S., Alexson, T., Tropepe, V., Donoviel, D., Elia, A. J., Nye, J. S., Conlon, R. A., Mak, T. W., Bernstein, A. and van der Kooy, D. (2002). Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells. Genes Dev. 16, 846-858.
Imai, T., Tokunaga, A., Yoshida, T., Hashimoto, M., Mikoshiba, K., Weinmaster, G., Nakafuku, M. and Okano, H. (2001). The neural RNA-binding protein Musashi1 translationally regulates mammalian numb gene expression by interacting with its mRNA. Mol. Cell. Biol. 21, 3888-3900.
Irwin, N., Baekelandt, V., Goritchenko, L. and Benowitz, L. I. (1997). Identification of two proteins that bind to a pyrimidine-rich sequence in the 3'-untranslated region of GAP-43 mRNA. Nucleic Acids Res. 25, 1281-1288.
Joseph, B., Orlian, M. and Furneaux, H. (1998). p21(waf1) mRNA contains a conserved element in its 3'-untranslated region that is bound by the Elav-like mRNA-stabilizing proteins. J. Biol. Chem. 273, 20511-20516.
Kaneko, Y., Sakakibara, S., Imai, T., Suzuki, A., Nakamura, Y., Sawamoto, K., Ogawa, Y., Toyama, Y., Miyata, T. and Okano, H. (2000). Musashi1: an evolutionally conserved marker for CNS progenitor cells including neural stem cells. Dev. Neurosci. 22, 139-153.[CrossRef][Medline]
Kanemura, Y., Mori, K., Sakakibara, S., Fujikawa, H., Hayashi, H., Nakano, A., Matsumoto, T., Tamura, K., Imai, T., Ohnishi, T. et al. (2001). Musashi1, an evolutionarily conserved neural RNA-binding protein, is a versatile marker of human glioma cells in determining their cellular origin, malignancy, and proliferative activity. Differentiation 68, 141-152.[CrossRef][Medline]
Kasashima, K., Terashima, K., Yamamoto, K., Sakashita, E. and Sakamoto, H. (1999). Cytoplasmic localization is required for the mammalian ELAV-like protein HuD to induce neuronal differentiation. Genes Cells 4, 667-683.[Abstract]
Kee, N., Sivalingam, S., Boonstra, R. and Wojtowicz, J. M. (2002). The utility of Ki-67 and BrdU as proliferative markers of adult neurogenesis. J. Neurosci. Methods 115, 97-105.[CrossRef][Medline]
Keene, J. D. (2001). Ribonucleoprotein infrastructure regulating the flow of genetic information between the genome and the proteome. Proc. Natl. Acad. Sci. USA 98, 7018-7024.
Kempermann, G., Jessberger, S., Steiner, B. and Kronenberg, G. (2004). Milestones of neuronal development in the adult hippocampus. Trends Neurosci. 27, 447-452.[CrossRef][Medline]
Kohn, D. T., Tsai, K. C., Cansino, V. V., Neve, R. L. and Perrone-Bizzozero, N. I. (1996). Role of highly conserved pyrimidine-rich sequences in the 3' untranslated region of the GAP-43 mRNA in mRNA stability and RNA-protein interactions. Brain Res. Mol. Brain Res. 36, 240-250.[Medline]
Lakshmipathy, U. and Verfaillie, C. (2005). Stem cell plasticity. Blood Rev. 19, 29-38.[CrossRef][Medline]
Lal, A., Mazan-Mamczarz, K., Kawai, T., Yang, X., Martindale, J. L. and Gorospe, M. (2004). Concurrent versus individual binding of HuR and AUF1 to common labile target mRNAs. EMBO J. 23, 3092-3102.[CrossRef][Medline]
Levine, T. D., Gao, F., King, P. H., Andrews, L. G. and Keene, J. D. (1993). Hel-N1: an autoimmune RNA-binding protein with specificity for 3' uridylate-rich untranslated regions of growth factor mRNAs. Mol. Cell. Biol. 13, 3494-3504.
Marusich, M. F., Furneaux, H. M., Henion, P. D. and Weston, J. A. (1994). Hu neuronal proteins are expressed in proliferating neurogenic cells. J. Neurobiol. 25, 143-155.[CrossRef][Medline]
Maslov, A. Y., Barone, T. A., Plunkett, R. J. and Pruitt, S. C. (2004). Neural stem cell detection, characterization, and age-related changes in the subventricular zone of mice. J. Neurosci. 24, 1726-1733.