spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 2 November 2004
doi: 10.1242/jcs.01512


Journal of Cell Science 117, 5825-5834 (2004)
Published by The Company of Biologists 2004
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.01512v1
117/24/5825    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin-Jones, J.
Right arrow Articles by Burnside, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin-Jones, J.
Right arrow Articles by Burnside, B.

Research Article

Myosin 3A transgene expression produces abnormal actin filament bundles in transgenic Xenopus laevis rod photoreceptors

Jennifer Lin-Jones*, Ed Parker, Mike Wu, Andréa Dosé and Beth Burnside

Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3200, USA

* Author for correspondence (e-mail: linjones{at}berkeley.edu)

Accepted 24 August 2004


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Myo3A, a class III myosin, localizes to the distal (plus) ends of inner segment actin filament bundles that form the core of microvillus-like calycal processes encircling the base of the photoreceptor outer segment. To investigate Myo3A localization and function, we expressed green fluorescent protein-tagged bass Myo3A and related constructs in transgenic Xenopus rods using a modified opsin promoter. Tagged intact Myo3A localized to rod calycal processes, as previously reported for native bass Myo3A. Transgenic rods developed abnormally large calycal processes and subsequently degenerated. Modified Myo3A expression constructs demonstrated that calycal process localization required an active motor domain and the tail domain. Expressed tail domain alone localized to actin bundles along the entire inner segment length, rather than to the distal end. This tail domain localization required the conserved C-terminal domain (3THDII) previously shown to possess an actin-binding motif. Our findings suggest that Myo3A plays a role in the morphogenesis and maintenance of calycal processes of vertebrate photoreceptors.

Key words: Myosin, Photoreceptors, Actin, Xenopus laevis, Calycal process


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Class III unconventional myosins are actin filament-dependent motor proteins with N-terminal kinase domains (Kalhammer and Bahler, 2000Go). Experimental evidence to date suggests that these myosins play roles in sensory cell function. The first myosin III family member cloned was Drosophila ninaC, which is expressed exclusively in visual photoreceptors (Montell and Rubin, 1988Go). Mutations in ninaC produce defects in phototransduction as well as light- and age-dependent photoreceptor degeneration. In vertebrates, two myosin III genes, myosin 3A and B, are expressed in retinal photoreceptors, while myosin 3A is also expressed in the ear (Dosé et al., 2003Go; Walsh et al., 2002Go). Recently, mutations of human MYO3A have been found to be responsible for progressive nonsyndromic deafness (Walsh et al., 2002Go).

In both fly and vertebrate photoreceptors, myosin 3 is associated with microvillus-like processes containing core actin filaments. The Drosophila ninaC gene encodes two alternatively spliced isoforms, p132 and p174. Although both are expressed in photoreceptors, p132 is found in the cell body while p174 localizes to the rhabdomeres, the photopigment-bearing microvilli that are the functional equivalent of vertebrate photoreceptor outer segments. In ninaC mutants, the organization of the core actin filaments of the rhabdomere microvilli is compromised (Hicks et al., 1996Go). In striped bass retina, myosin 3A is localized to the distal ends of actin filament bundles (Dosé et al., 2003Go) that form a cage beneath the cell membrane and extend from the outer limiting membrane through the inner segment to the tips of the microvillus-like calycal processes that cup the base of the outer segment (Nagle et al., 1986Go). Though calycal processes are nearly ubiquitous in vertebrate photoreceptors, their function is not understood.

The bundled actin filaments of the vertebrate photoreceptor inner segment are oriented with minus ends toward the nucleus and plus ends toward the distal ends of the calycal processes (O'Connor and Burnside, 1981Go). Since myosin 3A has been shown in vitro to be a plus-end directed motor (Komaba et al., 2003Go), one might expect it to translocate distally along the inner segment actin filament bundles toward the plus end and therefore accumulate in calycal processes. When bass Myo3A was expressed in transiently transfected HeLa cells, it accumulated at the distal ends of filopodia (Erickson et al., 2003Go), suggesting that in this heterologous system Myo3A does translocate to the plus ends of the actin filaments forming the filopodial core.

The tail regions of the different myosin classes are highly divergent and are generally thought to be specialized to mediate type-specific subcellular localization and/or implement distinct functions for the different myosins. Myosin 3A has two conserved domains within its tail region: 3 tail homology domains I and II (3THDI and II) (Dosé et al., 2003Go). 3THDI is a ~58 amino acid sequence found in all vertebrate class III myosins cloned to date, while 3THDII is a 22 amino acid region found only at the carboxyl terminus of vertebrate myosin IIIAs. Earlier studies in our laboratory showed that the distal accumulation of transiently expressed bass Myo3A in the filopodial tips of HeLa cells requires the presence of both an active motor and the terminal 3THDII domain (Erickson et al., 2003Go). This 3THDII motif possesses an actin-binding domain similar to that found in smooth muscle myosin light chain kinase (Erickson et al., 2003Go).

In this study, we identified elements of Myo3A required for localization to the distal photoreceptor inner segment and calycal processes using transgenic Xenopus laevis tadpoles in which expression was restricted to rod photoreceptors by the Xenopus rod opsin promoter. We also show that expression of the Myo3A transgene in rods leads to the formation of abnormally large calycal processes and subsequent rod degeneration. These observations suggest Myo3A plays a role in the morphogenesis and/or maintenance of rod calycal processes and of the actin cytoskeleton of photoreceptor inner segments.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Constructs used for transgenesis
The bass Myo3A expression plasmids used to generate transgenic Xenopus tadpoles are listed in Fig. 1. GFP:Myo3A, GFP:Myo3A (motor inactive), GFP:Myo3A{Delta}T and GFP:Myo3A{Delta}3THDII were constructed by using EcoRI and SalI inserts from GFP:M3, GFP:M3 inactive, GFP:M3{Delta}3THDI{Delta}3THDII and GFP:M3{Delta}3THDII expression plasmids (Erickson et al., 2003Go) for subcloning into an expression vector containing the modified Xenopus rod opsin promoter (XOP4) (Mani et al., 2001Go). The Myo3AT, Myo3AT{Delta}3THDII and 3THDII were cloned by PCR reactions using Myo3A cDNA and sequence-specific primers flanked by restriction enzyme sites for cloning. X-LKANKQTA (ctagtctagacctgaaggccaacaagcaaacagc) and KLIKQY-X (gatctctagatcagtactgtttgatgagctt) primers were used to amplify the Myo3A tail downstream of the last IQ motif; LKANKQTA (gaattcacctgaaggccaacaagcaaacagc) and AESHTDD-N (gcggccgctcagtcgtcagtatggctctccgcgg) primers amplified the Myo3A tail with the 3THDII domain deleted; and ENPYDFRHL (gattcacaatccgtacgacttcagacatc) and KLIKQY-N/S (gtcgacgcggccgctcagtactgtttgatgagctt) primers amplified the 3THDII domain. Myo3A PCR products were cloned using the pCRII-Topo cloning kit (Invitrogen) and sequenced. The Myo3AT insert was excised with XbaI and fused with GFP in the XOP:GFP vector (Knox et al., 1998Go). An AgeI and NotI GFP:Myo3AT insert was then purified and ligated into the XOP4 vector. The EcoRI/NotI insert containing the Myo3A tail with 3THDII deleted was ligated into the XOP4:GFP vector. 3THDII was fused to GFP in the EGFP-C3 expression vector (Clontech) using EcoRI and NotI sites; the GFP:3THDII was removed with AgeI and NotI and then ligated into XOP4. The XOP4:GFP plasmid was used as a control (Mani et al., 2001Go).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1. Schematic diagram of whole myosin 3A and myosin 3A transgenes. Shown at the top is Myo3A with its kinase (purple), motor (blue), nine IQ motifs (yellow), and tail domains 3THDI (red) and 3THDII (black). Below Myo3A are the various Myo3A transgenes that were fused to the C terminus of GFP (green) and expressed in Xenopus tadpole rods: the entire Myo3A protein (GFP:Myo3A), Myo3A with the motor inactivated by mutation (GFP:Myo3A – motor inactive), Myo3A with the tail beyond the IQ motifs deleted (GFP:Myo3A{Delta}T), Myo3A with 3THDII domain deleted (GFP:Myo3A{Delta}3THDII), the Myo3A tail fragment (GFP:Myo3AT), the Myo3A tail with 3THDII deleted (GFP:Myo3AT{Delta}3THDII), and the Myo3A tail domain 3THDII (GFP:3THDII). The GFP transgene alone was expressed as a control.

 

Xenopus transgenesis
Linearized plasmid DNA was used to generate transgenic frogs using a modified procedure based on the technique developed by Kroll and Amaya that has been described elsewhere (Lin-Jones et al., 2003Go).

Light and electron microscopy
Tadpoles that were generated by plasmid injection were screened for GFP fluorescence 4-5 days following injection. Tadpoles exhibiting fluorescence in their retinas were selected and eye fluorescence was monitored daily. Wild-type and transgenic eyes were dissected from tadpoles at various times after fertilization. The eyes were punctured with a tungsten needle and one eye was fixed and processed for fluorescence microscopy and the other was fixed and processed for electron microscopy (Lin-Jones et al., 2003Go). 8-12 µm retinal sections prepared for fluorescence microscopy were stained with a 1:40 dilution of Texas-Red-phalloidin (Molecular Probes) after permeabilization with 0.1% Triton X-100 in PBS for 5 minutes. Tadpole bodies were frozen at –80°C for genomic PCR analysis to verify the presence of the transgene.

8-12 µm retinal sections were viewed with an inverted Axiovert S100 microscope (Carl Zeiss) using an oil-immersion, plan-apochromat 63X/NA 1.4 objective. Z-series stacks of images were captured with a cooled CCD camera (Hamamatsu, model C4742-95) and recorded digitally with Openlab software (Improvision). The Z-series stacks were deconvolved using either the Openlab nearest neighbor or iterative deconvolution software modules.

The number and cross-sectional area of calycal processes from a minimum of 20 rods were quantified from electron micrographs of transgenic and wild-type rods in cross section using NIH Image software. The rod:cone ratios of transgenic and wild-type retinas from tadpoles fixed 7-9 days after fertilization were determined by counting the numbers of rods and cones from three to five 0.5 µm retinal sections from each tadpole eye. The average rod:cone ratio was calculated from multiple GFP:Myo3A, GFP or wild-type tadpoles that were 7-9 days old. The differences between transgenic and control rod:cone ratios, numbers of calycal processes/rod and total calycal process cross-sectional area per rod were examined statistically by analysis of variance (ANOVA).


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of GFP:Myo3A in Xenopus rod photoreceptors results in abnormally large calycal processes
We generated transgenic Xenopus laevis tadpoles expressing fusion proteins of the entire bass Myo3A protein or various domains of Myo3A tagged to the C-terminal end of GFP (Fig. 1). Controls expressing GFP alone were also generated. Transgene expression was restricted to rod photoreceptors by the use of a modified Xenopus rod opsin promoter (Mani et al., 2001Go). GFP fluorescence from transgene expression was detected exclusively in the retina and pineal gland of tadpoles (data not shown). Onset of fluorescence from transgene expression was detected at approximately stage 40 as has been reported previously (Knox et al., 1998Go). Transgene expression was mosaic within the retina and expression levels were variable among rods within a transgenic retina as has been observed previously (Lin-Jones et al., 2003Go; Moritz et al., 2001Go).

In transgenic tadpoles expressing the complete Myo3A coding region fused to GFP (GFP:Myo3A), fusion protein fluorescence (Fig. 2A, green) was associated predominantly with the distal ends of rod inner segment actin filament bundles that could be visualized by phalloidin staining (Fig. 2A, red). Fluorescence from the GFP:Myo3A was not found in the proximal inner segment actin filament bundles but co-localized with the terminal distal ends of inner segment actin filament bundles that form the core of calycal processes. Phalloidin staining was not fully colocalized with GFP:Myo3A fluorescence, because the presence of GFP:Myo3A appears to reduce phalloidin binding to actin filaments. A reduction in phalloidin binding to actin filaments by Myo3A was also observed in retinal sections labeled with Myo3A antibody and phalloidin (unpublished observations). Our finding that transgenic GFP:Myo3A protein localizes to distal actin filament bundles in Xenopus photoreceptors is consistent with our previous findings in striped bass retina labeled with Myo3A antibody that showed endogenous Myo3A protein to be specifically localized to the distal end of fish photoreceptor inner segment actin filament bundles and calycal processes (Dosé et al., 2003Go). In transgenic Xenopus, we were surprised to see that some GFP:Myo3A fluorescence extended beyond the normal calycal processes, even protruding into the retinal pigmented epithelium (RPE) layer (Fig. 2A, white arrows). In some rods, especially those from earlier stages of tadpoles, GFP:Myo3A fluorescence was also found in the inner segment cytosol. Distal actin filament bundle co-localization was observed in 28 transgenic GFP:Myo3A tadpoles ranging from stages 42 to 48. The presence of the transgene was confirmed by PCR of genomic DNA extracted from the tadpole bodies using primers designed against GFP and Myo3A (data not shown). In control tadpoles expressing GFP alone fluorescence was observed in both the cytosolic (inner segment, connecting cilium and synapse) and nuclear compartments of rods (Fig. 2C), as reported previously (Knox et al., 1998Go).



View larger version (99K):
[in this window]
[in a new window]
 
Fig. 2. Transgenic Myo3A fusion protein localizes to the distal end of Xenopus rod inner segment actin filament bundles. The entire Myo3A protein fused to the C-terminal of GFP (GFP:Myo3A) was used to make transgenic Xenopus that express the transgene in rod photoreceptors using a modified Xenopus rod opsin promoter. (A) In a section from a GFP:Myo3A transgenic tadpole retina stained with Texas-Red phalloidin to visualize actin filament bundles, GFP:Myo3A (green) accumulates at the distal end of phalloidin-stained actin filament bundles (red). Arrows indicate the presence of the fusion protein at the distal end of actin filament bundles that protrude into the retinal pigmented epithelium (RPE). No fluorescence was detected in the rod nuclei (N). (B) Diagram of the structural features of rod photoreceptors and the overlying RPE layer in retinal sections of the photoreceptor. OS, outer segment; CP, calycal processes; IS, inner segment; CC, connecting cilium; N, nucleus; S, synapse. Actin filament bundles in photoreceptors extend from the inner segment and terminate in the calycal processes surrounding the proximal outer segment in rod photoreceptors. (C) A retinal section from a control GFP transgenic tadpole retina exhibits fluorescence in rod nuclear (labeled with DAPI, blue) and cytosolic (inner segment, synapse and connecting cilium) compartments of rods. The arrow in panel C indicates fluorescence in the connecting cilium. Scale bar: 10 µm.

 

Tadpole retinas expressing the GFP:Myo3A transgene were examined by electron microscopy to ascertain whether any structural abnormalities were induced by transgenic GFP:Myo3A expression. In retinas of tadpoles expressing GFP:Myo3A, inner and outer segments appeared normal; however numerous rods in these retinas contained aberrantly long and broad calycal processes. These abnormally large calycal processes were not seen in rods from retinas of wild-type tadpoles or transgenic tadpoles expressing GFP only. Rod calycal processes in GFP:Myo3A retinas (Fig. 3A,C, arrows) were much broader and longer than those of wild-type rods (Fig. 3B, arrows). In GFP:Myo3A transgenic retinas we sometimes observed calycal processes that were so abnormally long that they extended beyond the rod outer segments to penetrate the RPE layer (Fig. 3C, arrow). This finding was corroborated by the observation that fluorescent processes extended into the RPE layer of GFP:Myo3A retinas (Fig. 2A). The enlarged calycal processes of GFP:Myo3A comprised tightly packed actin filament bundles (Fig. 3C, inset). We also examined rod cross sections to compare the diameters of calycal processes in retinas of wild-type and Myo3A transgenic tadpoles (Fig. 3D,E). Both normal-sized (white arrows) and abnormally large calycal processes (or "clubs," white arrowheads) were observed in individual transgenic rods from GFP:Myo3A retinas (Fig. 3E). No such large processes were seen in wild-type rods, although there was some variation in calycal process diameter (Fig. 3D). A higher magnification view of a large club from Fig. 3E reveals a greater number of actin filaments (Fig. 3G) than in calycal processes of wild-type tadpoles (Fig. 3F). In retinas of GFP:Myo3A tadpoles, not all rods exhibited abnormally large calycal processes, consistent with the mosaic expression typical of Xenopus transgenics. Co-expression in tadpole rods of both GFP and untagged Myo3A on separate plasmids resulted in a pattern of Myo3A localization identical to that observed in GFP:Myo3A transgenics: Myo3A antibodies labeled the distal ends of rod calycal processes and electron microscopy revealed that clubs also formed (data not shown). These observations indicate that neither fusion protein localization nor the formation of enlarged calycal processes is affected by the GFP tag.



View larger version (122K):
[in this window]
[in a new window]
 
Fig. 3. Expression of the GFP:Myo3A transgene results in the formation of abnormally large rod calycal processes. Rods from a GFP:Myo3A transgenic retina contain thicker rod calycal processes (A,C, black arrows; E, white arrowheads) than those found in wild-type rods (B,D, arrows). In addition, a calycal process from a GFP:Myo3A rod protrudes into the RPE layer and extends beyond the normal distal boundary seen in wild-type rod calycal processes (C, arrow). Actin filament bundles are visible in a longitudinal section through an enlarged calycal process found in a GFP:Myo3A retina (C, inset). Cross-sections of rod outer segments from wild-type (D) and GFP:Myo3A transgenic tadpoles (E) contain numerous normal-sized calycal processes (white arrows) but two abnormally large calycal processes are observed in the GFP:Myo3A retina (white arrowheads). Actin filament bundles are present in rod calycal processes of a wild-type retina (F) and of the GFP:Myo3A retina (G; boxed region in E), but there are fewer actin filament bundles visualized in the wild-type calycal process compared with the enlarged calycal process in the GFP:Myo3A retina. Scale bars: (A-C) 2 µm; (inset in C) 0.2 µm; (D,E) 1 µm; (F,G) 0.25 µm.

 

In order to quantify the effect of GFP:Myo3A transgene expression on rod calycal process size and number, we examined at least 20 rods from each of two GFP:Myo3A retinas and from control wild-type and GFP tadpoles (Fig. 4). In rods of control tadpole retinas, the majority of calycal processes had cross-sectional areas ≤0.01 µm2 and no calycal processes had cross-sectional areas ≥0.03 µm2. While GFP:Myo3A transgenic rods also possessed calycal processes with areas ≤0.03 µm2, many had areas ≥0.03 µm2. Therefore, for purposes of further quantification calycal processes ≤0.03 µm2 in area are considered to be `normal' calycal processes and those ≥0.03 µm2 to be abnormally enlarged clubs (Table 1). The largest abnormal club found in rods of transgenic GFP:Myo3A tadpoles was approximately eight times greater in cross-sectional area than the largest normal calycal process found in rods of wild-type and GFP control tadpoles. The higher percentage of rods containing larger clubs observed in GFP:Myo3A number 1 transgenic retina compared with no. 2 (see Table 1) is consistent with the reported interanimal variation in transgene mosaicism and the variable expression levels found within transgenic retina (Lin-Jones et al., 2003Go; Moritz et al., 2001Go).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4. GFP:Myo3A transgenic retinas contain rod calycal processes with increased cross-sectional area. Cross-sections of rods from two GFP:Myo3A, a wild-type and GFP control retina similar to those shown in Fig. 3D and E were used to measure the cross-sectional area of calycal processes from randomly chosen rods. For each rod, the calycal processes were categorized by size (cross-sectional area), and the average percentage of calycal processes per rod within a cross-sectional area range was plotted for each experimental and control tadpole retina. Note that the first three bins on the x-axis represent 0.01 µm2 and together represent the size of the remaining six bins (0.03 µm2). Rod calycal processes with cross-sectional areas less than 0.03 µm2 were seen in both control and experimental retinas, but only rods from the two GFP:Myo3A transgenic tadpoles contained calycal processes larger than 0.03 µm2. In the wild-type and GFP control retinas most of the calycal processes had cross-sectional areas less than 0.01 µm2 but a few were in the ranges 0.01-0.02 and 0.02-0.03 µm2. Therefore, any calycal processes less than 0.03 µm2 in cross-sectional area are within the normal range, while those greater than 0.03 µm2 are defined as being clubs, since calycal processes of this size are never found in wild-type or control rods.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Analysis of rod calycal process cross-sectional area of control and experimental Xenopus tadpole retina

 

GFP:Myo3A transgenic rods not only possessed enlarged clubs but also possessed fewer normal calycal processes than wild-type rods (Table 2). In one of the transgenic GFP:Myo3A retinas we examined (GFP:Myo3A no. 2 in Tables 1 and 2 and Fig. 4), the number of rod calycal processes was significantly lower in rods with clubs compared with rods without clubs from the same retina, or rods from wild-type retinas (Table 2, P<0.01). The number of calycal processes in GFP:Myo3A transgenic rods lacking clubs was not significantly different from that in wild-type rods. Comparison of the total calycal process cross-sectional areas in these samples suggests that despite the decrease in calycal process number in rods with clubs from the GFP:Myo3A retina, there may be some conservation of the total area in the perturbed retinas. A similar trend of reduced calycal process number in club-containing rods of the GFP:Myo3A no.1 retina shown in Table 1 and Fig. 4 was also observed but the small number of rods with no clubs precluded a useful comparison.


View this table:
[in this window]
[in a new window]
 
Table 2. Analysis of numbers of calycal processes/rod and total calycal process area/rod

 

GFP:Myo3A transgene expression leads to rod apoptosis
Living GFP:Myo3A tadpoles were monitored daily for visible fluorescence through the pupil. In transgenic tadpoles originally exhibiting bright eye fluorescence at day 4 after fertilization, GFP:Myo3A fluorescence became undetectable several days after it appeared. To determine whether the loss of fluorescence resulted from a loss of rod photoreceptors expressing the transgene, rods and cones were counted in 0.5 µm retinal sections from GFP:Myo3A, GFP and wild-type tadpoles (Fig. 5). Regions of the GFP:Myo3A retina (indicated by arrows in Fig. 5A) were depleted of rods compared with other areas within the retina or to wild-type retina (Fig. 5B). In higher magnification micrographs of a GFP:Myo3A retina (Fig. 5C), the distribution of cones (characterized by inner segment lipid droplets) was similar to that of wild type (Fig. 5D) but there was a notable paucity of rod inner segments in this area of the transgenic retina compared with the mosaic of rods and cones in the wild-type retina. Fig. 6 compares rod:cone ratios of retinas from GFP:Myo3A tadpoles fixed 7-9 days after fertilization with ratios from GFP transgenic control and wild-type animals. A statistically significant reduction (P<0.001) in the average rod:cone ratio was observed in tadpoles containing the GFP:Myo3A transgene compared with those containing the control GFP transgene or from wild-type retinas. There was no significant difference between the rod:cone ratios of wild-type and transgenics expressing GFP alone or between rod:cone ratios from tadpoles fixed 7, 8 or 9 days after fertilization for any of the treatment groups. The rod:cone ratios for the controls were consistent with those observed previously in another study (Lin-Jones et al., 2003Go). Our data suggest that rod expression of the transgenic Myo3A fusion protein induces the formation of abnormally large calycal processes and death of expressing rods by 7 days after fertilization.



View larger version (131K):
[in this window]
[in a new window]
 
Fig. 5. Retinas containing the GFP:Myo3A transgene have reduced numbers of rod photoreceptors compared with cones. (A) GFP:Myo3A retina with areas that have reduced numbers of rods (arrows) compared with other regions within the retina and to wild-type retina (B). The other retinal layers in the transgenic eye are unaffected by the transgene. (C) The GFP:Myo3A retina contains predominantly cone photoreceptors (C) that are characterized by lipid droplets in their inner segment and fewer rods. No rod inner segments and only a few rod outer segments (ROS) are observed in the transgenic retina unlike the greater number of intact rod inner and outer segments interspersed with cones found in a wild-type retina (D). N, nucleus. Scale bars: (A,B) 100 µm; (C,D) 1 µm.

 


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 6. Expression of transgenic GFP:Myo3A causes rod cell death in the retina. Three to four 0.5 µm sections from transgenic and control tadpole retinas were counted to determine the average rod:cone ratio for retinas from GFP:Myo3A (black), GFP (gray) and wild-type (white) tadpoles. The average rod:cone ratio in GFP:Myo3A transgenic retina (1.06±0.020, n=18 tadpole retinas) was reduced compared with control GFP transgenic (1.62±0.020, n=15 tadpoles retinas) and wild type (1.78±0.056, n=14 tadpole retinas) retina. The reduction in the rod:cone ratio from GFP:Myo3A retinas compared with either GFP or wild-type retinas was statistically significant (P<0.001) presumably because of the death of rods expressing the Myo3A transgene. There was no difference in average rod:cone ratios of control transgenic GFP and wild-type retinas. Error bars, standard error of the mean.

 

Motor activity and the tail domain are required for Myo3A localization to the distal end of inner segment actin filament bundles
To examine the requirements for Myo3A fusion protein localization to the distal inner segment actin filament bundles, three modified GFP:Myo3A fusion proteins were expressed in transgenic Xenopus rods (Fig. 1). The first transgene, GFP:Myo3A (motor inactive), contained GFP fused to Myo3A containing a point mutation previously shown to inactivate motor activity (Shimada et al., 1997Go). We created an arginine to alanine mutation at the conserved arginine 507 residue of the Myo3A motor domain; this mutation mimicked the R238A mutation in Dictyostelium myosin II shown by Shimada and coworkers (Shimada et al., 1997Go) to inactivate ATPase activity and block motility. In our previous transfection studies in HeLa cells, this R507A mutant Myo3A fusion protein does not, like intact GFP:Myo3A, localize to the distal ends of filopodia (Erickson et al., 2003Go).

Since the tail domain of many myosins mediates subcellular localization, we tested the role of the tail in Myo3A localization by producing deletion transgenes: (1) GFP fused to Myo3A lacking the tail region downstream of the last tail IQ motif (GFP:Myo3A{Delta}T) and (2) GFP:Myo3A with only the terminal 22 amino acids (3THDII) deleted (GFP:Myo3A{Delta}3THDII). In the first of these transgenes the deleted carboxyl portion of the tail includes both conserved Myo3A tail domains: 3THDI and 3THDII. In our previous HeLa cell transfection study, deletion of only the C-terminal 3THDII was sufficient to abolish localization to the distal actin filament bundles of filopodia (Erickson et al., 2003Go). For these transgenes we examined the pattern of fusion protein localization in at least nine transgenic tadpoles for each of the three different transgenes and confirmed the presence of the transgene by PCR of genomic DNA extracted from the tadpole bodies. The importance of the kinase domain for Myo3A localization was not examined in this study, since its localization in HeLa cells was not dramatically affected when the kinase domain was deleted (Erickson et al., 2003Go).

Mutational inactivation of the Myo3A motor domain [GFP:Myo3A (motor inactive)] and elimination of the Myo3A tail region (GFP:Myo3A{Delta}T) both produced diffuse distribution of the fluorescent transgene product throughout the rod cytosolic compartment (Fig. 7A,B). This diffuse localization contrasts with the specific localization to the distal ends of inner segment actin filament bundles that occurs when intact GFP:Myo3A protein is expressed (Fig. 2A). In rods expressing GFP:Myo3A (motor inactive) and GFP:Myo3A{Delta}T transgenic tadpoles, fluorescence was not present in the nucleus and outer segment but was present throughout the inner segment, synapse and connecting cilium. These results suggest that both a functional motor domain and the tail domain of Myo3A are necessary for the protein to localize and concentrate towards the distal ends of the inner segment actin filament bundles. No obvious morphological defects were observed by light microscopy in retinal sections from transgenic GFP:Myo3A (motor inactive) and GFP:Myo3A{Delta}T tadpoles. Eye fluorescence in live transgenic GFP:Myo3A (motor inactive) and GFP:Myo3A{Delta}T tadpoles was substantially weaker than in intact GFP:Myo3A or GFP control tadpoles. Thus, we were not able to ascertain whether fluorescence persisted in later stages of these transgenic tadpoles.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 7. Motor activity and the Myo3A tail are required for Myo3A localization to the distal end of inner segment actin filament bundles. (A) A retinal section from a transgenic tadpole containing the GFP:Myo3A (motor-inactive) protein displayed fluorescence in the inner segment (IS), connecting cilium (arrow) and synapse (arrowhead). (B) Deletion of the Myo3A tail (GFP:Myo3A{Delta}T) also resulted in fluorescence confined to the cytosol of the rod inner segment, connecting cilium and synapse. (C) Fluorescence from a GFP:Myo3A transgene with a deletion of the 22 amino acid 3THDII domain (GFP:Myo3A{Delta}3THDII) localized to inner segment actin filament bundles (arrow) but also displayed extensive levels of fluorescence in the inner segment cytosol and synapse. (D) In addition to cytosolic fluorescence, an accumulation of fluorescence from GFP:Myo3A{Delta}3THDII was also observed in the distal ends of actin filament bundles (arrows). None of the nuclei of transgenic retinas exhibited fluorescence (N, blue DAPI label). RPE, retinal pigmented epithelium; OS, outer segment. Scale bar: 10 µm.

 

To test whether the tail domain needed for localization was the terminal 3THDII region, we also expressed a transgene lacking only this domain (GFP:Myo3A{Delta}3THDII) in Xenopus rods. Fluorescence from this fusion protein localized to both the inner segment actin filament bundles (Fig. 7C,D, arrows) and the inner segment cytosol. Fluorescence from the GFP:Myo3A{Delta}3THDII fusion protein was sometimes observed extending into the RPE, suggesting that some calycal processes in GFP:Myo3A{Delta}3THDII rods are longer than those in wild types. This result is similar to the finding with GFP:Myo3A rods and further suggests that this construct may induce clubs in a manner similar to intact GFP:Myo3A. However, the intact GFP:Myo3A transgene produces much lower levels of diffuse fluorescence in the inner segment cytosol and more fluorescence in the distal inner segment actin filament bundles than GFP:Myo3A{Delta}3THDII (compare Fig. 2A and Fig. 7C). This observation suggests that distal calycal process localization still occurs but is less effective when the conserved 3THDII domain is absent. In general, the rod phenotype of the GFP:Myo3A{Delta}3THDII tadpoles was not as robust as that of the intact GFP:Myo3A animals; the overall fluorescence in GFP:Myo3A{Delta}3THDII rods was less intense and there was less fluorescence in the distal actin filament bundles. These results suggest that GFP:Myo3A{Delta}3THDII is not transported as efficiently, is less stable, or is not able to accumulate near the distal ends of inner segment actin filament bundles. Because the overall fluorescent signal from the GFP:Myo3A{Delta}3THDII tadpoles was so weak, we were unable to determine whether the eye fluorescence diminished with time. In electron microscopy of GFP:Myo3A{Delta}3THDII retinas, we were unable to detect any clubs or signs of rod degeneration.

The actin binding 3THDII domain in the Myo3A tail domain mediates Myo3A tail localization to actin filament bundles throughout the rod inner segment
To examine the roles of tail domains further we generated Xenopus transgenics expressing three different GFP fusion Myo3A tail domain constructs: (1) the Myo3A tail region downstream of the last tail IQ motif (GFP:Myo3AT), (2) the same Myo3A tail region with 3THDII deleted (GFP:Myo3AT{Delta}3THDII) and (3) the Myo3A 3THDII alone (GFP:3THDII), and analyzed their subcellular localization in rod photoreceptors. In rods expressing the whole tail (GFP:Myo3AT), fluorescence was localized to actin filament bundles (Fig. 8A). This finding is consistent with results from the tail deletion transgenics (GFP:Myo3A{Delta}T) in which the fusion protein failed to localize to actin filament bundles, suggesting that the tail region beyond the IQ motifs is required for actin filament co-localization. The GFP:Myo3AT fluorescence was uniformly distributed along the length of the inner segment actin filament bundles rather than concentrated at the distal end of the calycal processes like GFP:Myo3A. This finding is consistent with the failure of Myo3A with the inactive motor domain to localize distally and suggests that motor activity is necessary to concentrate Myo3A at the distal ends of the actin filament.



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 8. 3THDII is important for Myo3A tail localization to inner segment actin filament bundles. (A) The Myo3A tail fusion protein (GFP:Myo3AT, green) co-localized with inner segment actin filament bundles (stained red with phalloidin) as well as being localized to the rod inner segment cytosol (IS) and nuclei (N). (B) Elimination of 3THDII from the Myo3A tail fusion protein (GFP:Myo3AT{Delta}3THDII) resulted in fluorescence being confined to cytosolic compartments of rods and not inner segment actin filament bundles. Instead, fluorescence is located in the rod connecting cilium (arrow), inner segment, and synapse but is excluded from the outer segment (OS) and nucleus (N, labeled in blue with DAPI). (C) Fluorescence from a GFP:3THDII fusion protein in inner segment actin filament bundles, inner segment cytosol and nuclei of rods. RPE, retinal pigmented epithelium. Scale bar: 10 µm.

 

Removing the terminal 3THDII domain from the expressed Myo3A tail fragment abolished localization of fluorescence to actin filament bundles. Fluorescence from GFP:Myo3AT{Delta}3THDII was distributed throughout the cytosol of the inner segment, connecting cilium and synapse (Fig. 8B), suggesting that 3THDII was responsible for association of the expressed tail domain with inner segment actin bundles.

When 3THDII alone was expressed as a GFP fusion protein, fluorescence was found in the actin filament bundles of both calycal processes and inner segments and some diffuse labeling was seen in the cytosol (Fig. 8C). GFP:3THDII also localized to rod nuclei, suggesting that there may be some retention in the nucleus after diffusion of the fusion proteins across the nuclear pores because of their small size. No obvious defects in rod morphology were detected by light microscopy in transgenic retinas expressing any of the Myo3A tail fusion protein variants, despite the high expression levels driven by the rod opsin promoter. A minimum of seven tadpoles were examined by fluorescence microscopy for each of the different Myo3A tail transgenes and the presence of the transgene was confirmed for each by PCR of genomic DNA.


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To seek clues to Myo3A function in photoreceptors we have expressed GFP-tagged bass Myo3A and related Myo3A transgene constructs in Xenopus rods using a Xenopus rod opsin promoter. Although we have not yet succeeded in cloning Xenopus Myo3A and our existing Myo3A antibodies do not cross react with Xenopus homologues, our approach nonetheless provides valuable new information as it is the first experimental intervention to permit functional analysis of vertebrate Myo3A in photoreceptors in vivo. Although we have not directly demonstrated that Myo3A is expressed in Xenopus rods, this seems probable since Myo3A has so far been found in all other vertebrates examined (Dosé et al., 2004Go). Transgenic GFP-tagged bass Myo3A localizes to calycal processes in Xenopus rods just as the endogenous protein does in striped bass (Dosé et al., 2003Go), indicating that localization signals function appropriately in this heterologous system. This approach provides numerous advantages over studies in other heterologous systems, such as cultured HeLa cells (Erickson, et al., 2003Go) where Myo3A is not normally expressed and hence interacting photoreceptor-specific proteins responsible for Myo3A localization are probably not present.

Although it is one of the most powerful experimental systems now available for in vivo functional analysis, the transgenic Xenopus expression system is hampered by mosaic expression and variable expression levels, thus making interpretation of transgene effects in Xenopus rods challenging (Lin-Jones et al., 2003Go; Moritz et al., 2001Go). Transgene expression remains mosaic even in F1 tadpoles, despite transgene transmission through the germline; the mechanism responsible for this mosaicism is not understood. The mosaicism makes identification of a transgenic phenotype more difficult; a dramatic morphological change is required, one that can be detected at the light microscope level in GFP-expressing rods (such as the enlarged calycal processes and rod degeneration reported here). More subtle defects caused by transgene expression are difficult to document and thus may be overlooked. Interpretation of transgenic phenotype is further complicated by the variable levels of expressed protein produced. For example, although both transgenes were driven by the same promoter, GFP alone always produced much brighter fluorescence in transgenic rods than GFP fusions with Myo3A domains attached, and different transgenic rods within the same retina exhibited different levels of fluorescence. Because of these complications, the Xenopus system for expressing GFP-tagged transgenes in rods is more effective for analysis of domains important for subcellular targeting than for analysis of subtle phenotypic effects on rods. However, since culture systems in which normal outer segment development and turnover can be maintained have not yet been achieved, in vivo expression studies such as these in Xenopus are particularly crucial to further our understanding of myosin function in photoreceptor development and maintenance.

Myo3A localization to photoreceptor calycal processes
The localization of both endogenous bass Myo3A and transgenic GFP:Myo3A to Xenopus rod calycal processes suggests that Myo3A may accumulate at the distal ends of inner segment actin filament bundles by walking along the filaments toward their plus ends. This suggestion is consistent with previous reports that human MYO3A exhibits plus-end directed motor activity in vitro (Komaba et al., 2003Go) and that actin filaments in the photoreceptor inner segment bundles are oriented with their plus ends toward the calycal processes (O'Connor and Burnside, 1981Go). That Myo3A depends upon the action of its own motor for distal accumulation is further suggested by the failure of motor-inactive GFP:Myo3A to localize to calycal processes. A similar accumulation of Myo3A at the distal plus ends of the core actin filament bundles of filopodia was observed in HeLa cells transiently transfected with GFP-tagged bass Myo3A, and this distal accumulation too was dependent on the presence of an active Myo3A motor (Erickson et al., 2003Go). Myosins X and XV similarly concentrate in the distal ends of cultured cell filopodia (Belyantseva et al., 2003Go; Berg and Cheney, 2002Go).

Our studies with modified GFP-tagged Myo3A transgenes indicate that not only motor activity but also some site in the tail domain C-terminal to the last IQ motif is also required for distal localization in calycal processes. Two conserved motifs have been identified within this Myo3A tail region: 3THDI, found in both Myo3A and Myo3B of all vertebrate class III myosins sequenced to date; and 3THDII, a 22 amino acid C-terminal motif found only in vertebrate Myo3A (Dosé et al., 2003Go). 3THDII possesses a consensus actin-binding motif (DFRXXL) first identified in smooth muscle light chain kinase (Smith et al., 1999Go), and bacterially expressed 3THDII has been shown in vitro to have actin filament binding activity (Erickson et al., 2003Go). In HeLa cell transfection experiments, removing 3THDII from bass Myo3A constructs eliminated the ability of Myo3A to localize to the tips of filopodial processes (Erickson et al., 2003Go). In contrast, removing 3THDII from bass Myo3A expressed in Xenopus photoreceptors reduced but did not fully prevent accumulation in calycal processes. Thus a tail domain other than 3THDII located immediately downstream of the last IQ motif that includes 3THDI is critical for calycal process localization of Myo3A in photoreceptors, while 3THDII is the tail region required for distal filopodial localization of Myo3A in HeLa cells. This difference may reflect the participation of other photoreceptor-specific proteins in the localization in Xenopus.

Our expression/localization studies using Myo3A tail constructs alone showed that the tail domain downstream of the last IQ motif colocalized with actin filament bundles throughout the inner segment rather than localizing distally in calycal processes. As expected, this actin co-localization was mediated by the C-terminal conserved 3TDHII domain, consistent with our previous report that this domain contains an actin-binding motif (Erickson et al., 2003Go). It is interesting that despite the presence of the entire Myo3A tail region (including 3THDII) in both the intact and the motor inactive Myo3A, these fusion proteins do not colocalize with proximal actin filaments; Myo3A localizes to calycal processes and motor inactive Myo3A remains diffuse. Thus, in the context of the whole molecule, other Myo3A domains outside the tail region appear to regulate the binding of 3THDII to actin filament bundles. In transiently transfected HeLa cells a similar correlation was observed: the Myo3A tail domain alone colocalized with the actin filaments of stress fibers, while the intact GFP:Myo3A localized to filopodial tips and the motor-inactive GFP:Myo3A remained cytosolic (Erickson et al., 2003Go).

Our studies indicate that Myo3A localization to photoreceptor calycal processes requires both a functional motor and a region of the tail that does not bind directly to actin filaments. Since abnormal calycal process formation and rod degeneration were observed only in rods expressing intact transgenic Myo3A protein, effective localization to the distal end of calycal processes may be required to produce these phenotypes.

Effects of transgenic Myo3A expression on rod calycal process morphology
The appearance of abnormally large calycal processes (clubs) in transgenic rods expressing GFP:Myo3A suggests that Myo3A plays some role in calycal process morphogenesis and maintenance. This aberrant morphology is not produced by the attached GFP, since enlarged clubs were also induced by co-expressing separate GFP and Myo3A constructs. The clubs are much longer than normal calycal processes and contain many more actin filaments. The straight and stiff appearance of the clubs in electron micrographs suggests that the filaments are highly crosslinked. Transgenic expression of Myo3A may have disrupted normal calycal process morphogenesis in expressing rods by enhancing nucleation, stabilization or crosslinking of actin filaments. We cannot ascertain from our studies whether the effect of the Myo3A is direct or indirect. For example, effects of Myo3A transgene expression may be mediated by increased kinase activity or direct interactions with proteins affecting actin dynamics as has been described for yeast type I myosins (Myo3p and Myo5p), which have been shown to interact with the actin-binding protein Vrp1p (yeast WASP) and the Arp2/3 complex (Geli et al., 2000Go). In HeLa cells overexpressing transfected myosin X, actin filament dynamics in filopodia were altered so that filopodial length and number were increased (Berg and Cheney, 2002Go). In contrast, our lab found no detectable changes in filopodial length or number in HeLa cells transfected with Myo3A (F. L. Erickson, personal communication). Myosin X is expressed endogenously in HeLa cells while Myo3A is not. Myo3A may affect actin dynamics in photoreceptor calycal processes by interacting with proteins present in photoreceptors but not present in HeLa cells.

Loss of rods in transgenic retinas expressing Myo3A
The appearance of abnormally large calycal processes in rods expressing the Myo3A transgene correlated with subsequent rod degeneration. Green eye fluorescence appeared in transgenic tadpoles at day 4 and disappeared by day 7 after fertilization. By day 7, the rod:cone ratios of Myo3A transgenic retinas were significantly lower than those of wild-type and GFP control retinas of the same age. The mechanism by which transgene expression produced degeneration cannot be discerned from our studies. Although the inner and outer segments of rods with club-like calycal processes looked remarkably normal at the EM level, crucial actin cytoskeletal dynamics may have been altered in the transgenic photoreceptors so that processes necessary for maintenance and turnover were disrupted and susceptibility to apoptosis increased. The Xenopus rod promoter used to drive Myo3A expression is first activated at stage 40 when outer segments are first forming in Xenopus photoreceptors. Thus, Myo3A transgene expression driven by this promoter is more likely to act upon already existing inner segment actin filament bundles and nascent calycal processes than on earlier stages in the assembly of the inner segment actin cytoskeleton. In immunocytochemical studies of developing photoreceptors in the marginal zone of fish retinas, we found that Myo3A could first be detected during the formation of the inner segment (M. Wang, unpublished observations). Use of a photoreceptor-specific promoter that acts earlier during photoreceptor development will allow us to investigate whether earlier Myo3A transgene expression alters the initial morphogenesis of the photoreceptor inner segment.

Myo3A function in photoreceptors
Our observations suggest that as in Drosophila vertebrate Myo3A plays important roles in photoreceptor morphogenesis, function and survival. In the fly photoreceptor, NINAC has multiple functions that are mediated by different domains. The kinase domain is required for a normal electrophysiological photoresponse, while the tail domain is required for subcellular localization to rhabdomere microvilli and for association with the visual signal complex via interaction with the PDZ domain of INAD (Wes et al., 1999Go). Null mutants of ninaC undergo light-induced photoreceptor degeneration, suggesting a critical role for NINAC in photoreceptor maintenance.

Myosin 3A is also expressed in the cochlea of the inner ear, and its mutation in humans leads to non-syndromic hearing loss (Walsh et al., 2002Go). It is likely that these mutations affect the structure and function of the elaborate actin cytoskeleton of hair cells. Mutations in several other unconventional myosins (Ib, Ic, VI, VIIA, XV) have also been shown to cause deafness (Libby and Steel, 2000Go; Redowicz, 1999Go). Although mutations in myosin VIIA cause both deafness and retinal degeneration in humans (Weil et al., 1995Go), no visual defects have been associated with the deafness-inducing mutations of MYO3A, one of which is expected to function as a null. These observations suggest that Myo3A is not required for photoreceptor development, function and survival. However, two possible explanations might account for the lack of a retinal phenotype in the MYO3A deafness mutations. First, the mutations might affect splice variants expressed in the ear but not in the eye. Alternatively, there may be functional redundancy in photoreceptors but not in hair cells as a result of the expression of MYO3B or some other functionally equivalent motor. Myo3B, a closely related class III myosin, is expressed in photoreceptors in fish and in mice (J.L.-J. and B. Battelle, unpublished observations), but its function is not yet known.

The function of Myo3A in photoreceptors remains to be determined. The studies we report here have elucidated roles of specific domains in Myo3A subcellular location and have provided evidence that transgenic Myo3A induces the morphogenesis of abnormally large calycal processes and subsequent rod degeneration. Since Myo3A has a kinase domain and nine putative calmodulin-binding motifs in addition to its motor and actin-binding domain, it would not be surprising to find that it participates in a multiplicity of functions; cytoplasmic transport, cytoskeletal scaffolding and signaling are likely candidates. More studies will be required to tease out these roles.


    Acknowledgments
 
The authors thank Les Erickson for sharing his GFP:Myo3A plasmids and members of the Burnside lab for their comments. This work was supported by NIH grants EY 03575 (B.B.) and EY 06859 (J.L.-J.).


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Belyantseva, I. A., Boger, E. T. and Friedman, T. B. (2003). Myosin XVa localizes to the tips of inner ear sensory cell stereocilia and is essential for staircase formation of the hair bundle. Proc. Natl. Acad. Sci. USA 100, 13958-13963.[Abstract/Free Full Text]

Berg, J. S. and Cheney, R. E. (2002). Myosin-X is an unconventional myosin that undergoes intrafilopodial motility. Nat. Cell Biol. 4, 246-250.[CrossRef][Medline]

Dosé, A. C., Hillman, D. W., Wong, C., Sohlberg, L., Lin-Jones, J. and Burnside, B. (2003). Myo3A, one of two class III myosin genes expressed in vertebrate retina, is localized to the calycal processes of rod and cone photoreceptors and is expressed in the sacculus. Mol. Biol. Cell 14, 1058-1073.[Abstract/Free Full Text]

Dosé, A. C., Lin-Jones, J. and Burnside, B. (2004). Myosin III in photoreceptors: what does it do? In Cell Biology and Disease of the Outer Retina (ed. D. S. Williams). Hackensack, NJ: World Scientific.

Erickson, F. L., Corsa, A. C., Dosé, A. C. and Burnside, B. (2003). Localization of a class III myosin to filopodia tips in transfected HeLa cells requires an actin-binding site in its tail domain. Mol. Biol. Cell 14, 4173-4180.[Abstract/Free Full Text]

Geli, M. I., Lombardi, R., Schmelzl, B. and Riezman, H. (2000). An intact SH3 domain is required for myosin I-induced actin polymerization. EMBO J. 19, 4281-4291.[CrossRef][Medline]

Hicks, J. L., Liu, X. and Williams, D. S. (1996). Role of the ninaC proteins in photoreceptor cell structure: ultrastructure of ninaC deletion mutants and binding to actin filaments. Cell Motil. Cytoskeleton 35, 367-379.[CrossRef][Medline]

Kalhammer, G. and Bahler, M. (2000). Unconventional myosins. Essays Biochem. 35, 33-42.[Medline]

Knox, B. E., Schlueter, C., Sanger, B. M., Green, C. B. and Besharse, J. C. (1998). Transgene expression in Xenopus rods. FEBS Lett. 423, 117-121.[CrossRef][Medline]

Komaba, S., Inoue, A., Maruta, S., Hosoya, H. and Ikebe, M. (2003). Determination of human myosin III as a motor protein having a protein kinase activity. J. Biol. Chem. 278, 21352-21360.[Abstract/Free Full Text]

Libby, R. T. and Steel, K. P. (2000). The roles of unconventional myosins in hearing and deafness. Essays Biochem. 35, 159-174.[Medline]

Lin-Jones, J., Parker, E., Wu, M., Knox, B. E. and Burnside, B. (2003). Disruption of kinesin II function using a dominant negative-acting transgene in Xenopus laevis rods results in photoreceptor degeneration. Invest. Ophthalmol. Vis. Sci. 44, 3614-3621.[Abstract/Free Full Text]

Mani, S. S., Batni, S., Whitaker, L., Chen, S., Engbretson, G. and Knox, B. E. (2001). Xenopus rhodopsin promoter. Identification of immediate upstream sequences necessary for high level, rod-specific transcription. J. Biol. Chem. 276, 36557-36565.[Abstract/Free Full Text]

Montell, C. and Rubin, G. M. (1988). The Drosophila ninaC locus encodes two photoreceptor cell specific proteins with domains homologous to protein kinases and the myosin heavy chain head. Cell 52, 757-772.[CrossRef][Medline]

Moritz, O. L., Tam, B. M., Papermaster, D. S. and Nakayama, T. (2001). A functional rhodopsin-green fluorescent protein fusion protein localizes correctly in transgenic Xenopus laevis retinal rods and is expressed in a time-dependent pattern. J. Biol. Chem. 276, 28242-28251.[Abstract/Free Full Text]

Nagle, B. W., Okamoto, C., Taggart, B. and Burnside, B. (1986). The teleost cone cytoskeleton. Localization of actin, microtubules, and intermediate filaments. Invest. Ophthalmol. Vis. Sci. 27, 689-701.[Abstract/Free Full Text]

O'Connor, P. and Burnside, B. (1981). Actin-dependent cell elongation in teleost retinal rods: requirement for actin filament assembly. J. Cell Biol. 89, 517-524.[Abstract/Free Full Text]

Redowicz, M. J. (1999). Myosins and deafness. J. Muscle Res. Cell Motil. 20, 241-248.[CrossRef][Medline]

Shimada, T., Sasaki, N., Ohkura, R. and Sutoh, K. (1997). Alanine scanning mutagenesis of the switch I region in the ATPase site of Dictyostelium discoideum myosin II. Biochemistry 36, 14037-14043.[CrossRef][Medline]

Smith, L., Su, X., Lin, P., Zhi, G. and Stull, J. T. (1999). Identification of a novel actin binding motif in smooth muscle myosin light chain kinase. J. Biol. Chem. 274, 29433-29438.[Abstract/Free Full Text]

Walsh, T., Walsh, V., Vreugde, S., Hertzano, R., Shahin, H., Haika, S., Lee, M. K., Kanaan, M., King, M. C. and Avraham, K. B. (2002). From flies' eyes to our ears: mutations in a human class III myosin cause progressive nonsyndromic hearing loss DFNB30. Proc. Natl. Acad. Sci. USA 99, 7518-7523.[Abstract/Free Full Text]

Weil, D., Blanchard, S., Kaplan, J., Guilford, P., Gibson, F., Walsh, J., Mburu, P., Varela, A., Levilliers, J., Weston, M. D. et al. (1995). Defective myosin VIIA gene responsible for Usher syndrome type 1B. Nature 374, 60-61.[CrossRef][Medline]

Wes, P. D., Xu, X. Z., Li, H. S., Chien, F., Doberstein, S. K. and Montell, C. (1999). Termination of phototransduction requires binding of the NINAC myosin III and the PDZ protein INAD. Nat. Neurosci. 2, 447-453.[CrossRef][Medline]




This article has been cited by other articles:


Home page
IOVSHome page
J. Lin-Jones and B. Burnside
Retina-Specific Protein Fascin 2 Is an Actin Cross-linker Associated with Actin Bundles in Photoreceptor Inner Segments and Calycal Processes
Invest. Ophthalmol. Vis. Sci., March 1, 2007; 48(3): 1380 - 1388.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. C. Dose, S. Ananthanarayanan, J. E. Moore, B. Burnside, and C. M. Yengo
Kinetic Mechanism of Human Myosin IIIA
J. Biol. Chem., January 5, 2007; 282(1): 216 - 231.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kambara, S. Komaba, and M. Ikebe
Human Myosin III Is a Motor Having an Extremely High Affinity for Actin
J. Biol. Chem., December 8, 2006; 281(49): 37291 - 37301.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. E. Schneider, A. C. Dose, F. T. Salles, W. Chang, F. L. Erickson, B. Burnside, and B. Kachar
A New Compartment at Stereocilia Tips Defined by Spatial and Temporal Patterns of Myosin IIIa Expression
J. Neurosci., October 4, 2006; 26(40): 10243 - 10252.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.01512v1
117/24/5825    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin-Jones, J.