QUICK SEARCH:   [advanced] Author: Keyword(s):
Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents

First published online 16 September 2003
doi: 10.1242/jcs.00760

This Article Summary Figures Only Full Text (PDF) All Versions of this Article: jcs.00760v1 116/21/4373    most recent Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Herlevsen, M. Articles by Zöller, M. Search for Related Content PubMed PubMed Citation Articles by Herlevsen, M. Articles by Zöller, M.

The association of the tetraspanin D6.1A with the 6ß4 integrin supports cell motility and liver metastasis formation

Mikael Herlevsen^1,*, Dirk-Steffen Schmidt¹, Kaoru Miyazaki² and Margot Zöller^1,3,

¹ Department of Tumor Progression and Immune Defense, German Cancer Research Center, Heidelberg, Germany
² Division of Cell Biology, Kihara Institute for Biological Research, Yokohama City University, Yokahama, Japan
³ Department of Applied Genetics, University of Karlsruhe, Karlsruhe, Germany

Author for correspondence (e-mail: m.zoeller{at}dkfz.de)

Accepted 8 July 2003

	Summary

Top Summary Introduction Materials and Methods Results Discussion References

 
The metastatic subline of a rat pancreatic adenocarcinoma differs from the non-metastasizing subline by overexpression of 5 membrane molecules: CD44 variant isoforms, EpCAM, the tetraspanin D6.1A, an uPAR-related molecule and, as described here, the 6ß4 integrin. An antibody-defined molecule was identified by mass spectrometry and cloning as 6ß4 integrin. Transfection-induced expression of 6ß4 in the non-metastasizing subline did not support migration on laminin 5 or tumor progression. However, when the non-metastasizing subline was doubly transfected to express 6ß4 and the D6.1A tetraspanin, intraperitoneally injected tumor cells frequently formed liver metastasis. For the following reasons we assume that metastasis formation is supported by an interaction between 6ß4 and D6.1A. (i) The 2 molecules can associate and co-localize. (ii) Co-localization is strengthened by PKC stimulation. (iii) PKC stimulation, which induces a migratory phenotype, leads to a redistribution of 6ß4/D6.1A complexes. In resting cells, the molecules co-localize at the trail of the cell; during PKC stimulation they become transiently internalized and are (re-)expressed in the leading lamella. Thus, in the appropriate milieu, i.e. intraperitoneally, 6ß4 changes from an adhesion-supporting towards a migration-supporting molecule by its association with a tetraspanin. The findings provide a convincing experimental explanation for the repeatedly described involvement of 6ß4 in tumor progression.

Key words: 6ß4 integrin, Tetraspanin, Metastasis, Adhesion, Motility

	Introduction

Top Summary Introduction Materials and Methods Results Discussion References

 
Metastasis formation is a multistep process that requires partly opposing properties from the metastasizing tumor cells, such as, detachment from the primary tumor tissue and adhesion to vessel endothelium. It is supposed that the metastasizing tumor cell fulfills these distinct requirements by silencing and upregulation of expression of a whole set of genes, which as such may well be unaltered (Lozahic et al., 2000; Mareel et al., 1993; Poste and Fidler, 1980; MacDonald and Steeg, 1997). Though it is generally agreed that the metastasizing phenotype cannot be explained by alteration, upregulation or silencing of a single gene, not much is known about possible cooperation between `metastasis-associated' gene products and alterations of their functional activity by such an association.

We have described five monoclonal antibodies (mAb) that recognize surface molecules on metastasizing, but not on non-metastasizing rat tumor lines (Claas et al., 1996; Matzku et al., 1983). The molecules have been identified as CD44v4-v7 (Günthert et al., 1991), the tetraspanin D6.1A (Claas et al., 1998), C4.4A, a molecule with homology to uPAR (Rösel et al., 1998), D5.7A, the rat homologue of EpCAM (Würfel et al., 1999) and, described in this report, the 6ß4 integrin. Thus, all five molecules are presumably unaltered gene products and physiological functions of some of them are well described. Interestingly, all five are also known for their involvement in metastasis formation (reviewed by Zöller, 1998). The 6ß4 integrin is a receptor for laminin, preferentially for laminin 5 (Belkin and Stepp, 1999; Falk-Marzillier et al., 1998; Lee et al., 1992; Nguyen et al., 2000; Stahl et al., 1997) and is a major component of hemidesmosomes (Dowling and Fuchs, 1996; Jones et al., 1998; Niessen et al., 1997; Nievers et al., 1998). There are numerous reports that, dependent on the cell type, upregulation or downregulation of 6ß4 is required for tumor progression (reviewed by Mercurio and Rabinovitz, 2001; Zutter et al., 1998). In addition, increased motility and invasiveness is linked to PKC activation via the EGFR, which is accompanied by disintegration of hemidesmosomes (Gambaletta et al., 2000; Maniero et al., 1996; Rabinovitz et al., 1999; Rigot et al., 1998), the formation and stabilization of actin-containing motility structures (Rabinovitz and Mercurio, 1997) and the stimulation of MMP-2 secretion (Daemi et al., 2000; Sugiura and Berditchevski, 1999).

Tetraspanins have been described as molecular facilitators (Claas et al., 2001; Maecker et al., 1997; Todres et al., 2000). They form protein complexes that are mostly composed of different tetraspanins and integrins, but can also contain members of other protein families (Fitter et al., 1999; Horvath et al., 1998; Indig et al., 1997; Lozahic et al., 2000; Mannion et al., 1996; Rubinstein et al., 1997; Scherberich et al., 1998; Serru et al., 1999; Sincock et al., 1999; Tiwari-Woodruff et al., 2001; Yauch et al., 1998). The strongest association between tetraspanins and integrins has been described for CD151 and the 3 and 6 integrins (Sincock et al., 1999; Yauch et al., 1998; Yauch et al., 2000). For the rat tetraspanin D6.1A, which is closely related to CD9, we originally noted an association with the 3 and the 6ß1 integrin (Claas et al., 1996). Meanwhile, an association with the 6ß4 integrin was described for 2 tetraspanins (Baudoux et al., 2000; Jones et al., 1996; Sterk et al., 2000). CD151 associates with 6ß4 within hemidesmosomes (Sterk et al., 2000), whereas an association between CD9 and 6ß4 has only been observed outside of hemidesmosomes (Baudoux et al., 2000). The association between tetraspanins and integrins may be accompanied by changes in adhesiveness versus motility (Berditchevski and Odintsova, 1999; Domanico et al., 1997; Hinterman et al., 2001; Penas et al., 2000). As possible underlying mechanisms shedding, internalization and redistribution on the cell membrane have been discussed (Bretscher, 1992; Friedl et al., 1998; Gaietta et al., 1994; Nath et al., 2000). Tetraspanins are also known to contribute to the metastatic process (Charrin et al., 2001; Claas et al., 1998; Odintsova et al., 2000; Testa et al., 1999) (reviewed by Levy et al., 1998).

We have cloned the rat 6ß4 integrin, which is highly expressed on several metastasizing rat tumor lines, and show that 6ß4 expression on locally growing tumor lines does not confer the metastatic phenotype. Instead, there is evidence that co-expression of the 6ß4 integrin and the D6.1A tetraspanin contributes to the hematogeneous spread of tumor cells. Metastatic spread is supported by the acquisition of a motile phenotype via transient internalization and re-expression of the 6ß4 integrin and D6.1A at the leading edge of the tumor cell.

	Materials and Methods

Top Summary Introduction Materials and Methods Results Discussion References

 
Rats and tumor lines
BDX rats were obtained from WIGA, Sulzfeld, Germany, and were kept under conventional conditions. They were used for experiments at the age of 8-10 weeks. The pancreatic adenocarcinoma lines BSp73ASML (metastasizing) and BSp73AS (low metastasizing) are sublines from a tumor spontaneously arising in the BDX rat strain (Matzku et al., 1983). Regressor and Progressor are two related colon carcinoma lines, which metastasize via the lymphatic system (Reisser et al., 1993). The bladder carcinoma line 804G was a kind gift from Dr J. Jones, Northwestern University Medical School Chicago, IL, USA (Riddelle et al., 1991). 804G cells form hemidesmosomes in vitro and secrete laminin 5 (Ln5). BSp73AS cells, which express the 6 integrin chain were transfected with the ß4 integrin chain cDNA using the pIRESneo vector and selection in G418 (BSp73AS-ß4). Where indicated, the BSp73AS-ß4 cells were cotransfected with the D6.1A cDNA in the pKEX2XR vector and selected in hygromycin (BSp73AS-db). Cells were transfected by electroporation (Eurogentech Easyject, 260V, 1050µF). Positive clones (defined by FACS analysis) were recloned under limiting dilution conditions. BSp73AS cells transfected with the D6.1A cDNA (BSp73AS-D6.1A) have been described elsewhere (Claas et al., 1998). D6.1A cDNA cloned from pcDNA3 vector was fused at its C-terminal to EYFP (enhanced yellow fluorescence protein) cDNA in the EYFP fusion vector (Clontech) and was used for transient transfection of 804G cells. All cells were cultured in RPMI 1640 supplemented with 10% FCS. Confluent cultures were trypsinized and split.

Antibodies and staining procedures
The mAb A2.6 (anti-CD44v6), D6.1 (anti-D6.1A), C4.4 (anti-C4.4A), D5.7 (anti-D5.7A) and B5.5 (anti-6ß4), A8.10 (undefined specificity) have been described previously (Matzku et al., 1989). Ox50 (anti-rat CD44), B2C11 (anti-rat CD9) and Ralph3.1 (anti-rat 3) were obtained from the European Collection of Animal Cell Cultures. Hybridoma culture supernatants were purified by protein G-Sepharose FPLC (flow pressure liquid chromatography. Where indicated, purified antibodies were labeled with biotin or fluoresceinisothiocyanate (FITC) or Texas Red (TxR). The rat integrin-specific antibodies anti-ß1, -ß2, -ß4, anti-1, -2, -3, -4 and -6, anti-rat CD9 and unlabeled, biotin- and horseradish peroxidase (HRP)-conjugated as well as dye-labeled (FITC, phycoerythrin (PE), Cy-2 and TxR) secondary antibodies and dye-labeled streptavidin as well as TRITC-labeled phalloidin were obtained commercially (Becton Dickinson, Heidelberg, Germany).

Flow cytometry followed routine procedures using 3-5x10⁵ cells per sample. Trypsinized cell were allowed to recover for 2 hours at 37°C in RPMI 1640, 10% fetal calf serum (FCS). Samples were analyzed by FACSCalibur (Becton Dickinson, Heidelberg, Germany).

For immunofluorescence microscopy cells were seeded on cover slides, which had been pretreated with extracellular matrix (ECM) substrates. After spreading, slides were washed, cells were fixed in 4% paraformaldehyde (w/v in PBS) and, where indicated, were permeabilized (4 minutes in 0.1% Triton X-100). After washing and blocking [0.2% gelatin, 0.5% bovine serum albumin (BSA) in PBS], cells were incubated with the primary antibody at pretested concentrations (5-10 µg/ml) in PBS/BSA for 60 minutes at 4°C. Slides were rinsed and subsequently incubated for 60 minutes at 4°C with a fluorochrome-conjugated secondary antibody. After washing, cells were incubated with an excess of unlabeled mouse IgG to block potentially free binding sites of the dye-labeled anti-mouse IgG. Unlabeled mouse IgG was also added during incubation with the second, dye-labeled antibody. Cells were stained with a directly labeled second antibody or with phalloidin-TRITC (0.5 µg/ml) (F-actin) for an additional 60 minutes incubation at 4°C. For cross-linking experiments, cells were incubated at 37°C for 15 minutes with the primary antibody and for 20 minutes with an excess (10 µg/ml) of the secondary, dye-labeled antibody. Cells were washed with ice-cold PBS and all consecutive steps were performed at 4°C. After staining and washing 3 times in PBS and once in H₂O, slides were mounted in Elvanol. Digitized images were generated using a Leica DMRBE microscope equipped with a SPOT CCD camera from Diagnostic Instruments Inc. and Software SPOT2.1.2, or using a confocal microscope. Where indicated, cells had been pretreated with phorbolmyristate acetate (PMA) (10^–8 M) for 2 hours.

Substrates
Fibronectin (Fn) and collagen IV (Col IV) were obtained commercially (Sigma, Deisenhofen, Germany). Recombinant human laminin-5 (Ln5) was expressed in HEK293 cells and purified from the conditioned medium by immuno-affinity chromatography as reported recently (Kariya et al., 2002). In some experiments 804G supernatant was used as a source of Ln5 (Riddelle et al., 1991). Plates were coated with 10 µg/ml Fn and Col IV, 0.3 µg/ml recombinant Ln5 or undiluted 804G supernatant. After coating, free binding sites were blocked by incubation with PBS/1% BSA.

Purification and cloning of the rat 6 and ß4 integrin
Progressor cells (5x10⁸) were lysed in 25 mM Hepes, pH 7.2, 1% Triton X-114, 500 mM NaCl, 1 mM CaCl₂, 1 mM PMSF, diluted to 50 ml and was run over a B5.5-coated Sepharose 4B column. B5.5-bound material was eluted with 50 mM glycine buffer, pH 2.7, 500 mM NaCl, 0.1% Triton X-100 and was neutralized with 1 M Tris-HCl, pH 8.0. Fractions were analyzed by SDS-PAGE. Protein-containing fractions were pooled and precipitated by methanol/chloroform before being loaded on SDS-PAGE gels and stained with Coomassie Blue. Two bands at 200 kDa and 130 kDa were cut out, digested with trypsin and subjected to mass spectrometry.

To define the ß4 isoforms expressed in the metastasizing cells lines BSp73ASML, Progressor and Regressor, an expression analysis by RT-PCR was performed using primers to detect the ß4B (53aa insertion) and ß4C (70aa insertion) isoforms (AGAGGCCCAGCGTTTCAG and <reverse> TACCCGGAACACATAGGAGTG) the primers spanning base pairs 4293-4957 and the ß4D (7aa deletion) isoform (CTCTCTGCAGCTGAGCTGG and <reverse> TCACTGAGGCCAGGAACC) the primers spanning base pairs 5122-5280 (nucleotide numbers are from the rat ß4 sequence u60096, which includes the +53 variant). Total RNA was extracted by the guanidine isothiocyanate/acid phenol method of Chomzynski and Sacchi (Chomzynski and Sacchi, 1987). cDNA was synthesized from 2 µg total RNA and subjected to PCR amplification using the indicated primers. Amplification was performed at 60°C for 30 cycles.

From the rat 6 integrin chain two short sequences were known, EST AA955091 and a 265 bp fragment kindly provided by Dr L. Feltri, Institute San Rafaele, Milano, Italy (Feltri et al., 1997). Primers binding to these sequences were used together with pcDNA3-specific primers in an attempt to clone the full-length cDNA from a library of the Regressor line (Claas et al., 1998). Since the 5' end of the gene was not present in the library, it was cloned by the RACE technique using terminal transferase from 804G cells (submitted to EMB database, accession numbers AJJ12933 and AJJ12934).

For the transfection of BSp73AS cells with the ß4 integrin chain the cDNA was cloned into the pIRESneo vector. Three clones spanning bp 0-3143 (F14), bp 1875-5455 (L7) and bp 3684-5896 (L5) in the pBluescript SK+ vector were kindly provided by Dr L. Feltri (Institute San Rafaele, Milano, Italy). F14 was cut out with EcoRV and HindIII, was blunted and ligated into pIRESneo, which had been digested with EcoRV. L7 was digested with ClaI and BamHI (bp1946-3626) and cloned into pIRESneo-F14. L5 was digested with BamHI (bp 3626-5896) and was ligated into the pIRESneo-F14/L7part. Integrity of the cDNA was controlled by re-cleaving after ligation and association of the clone with the 6 integrin and staining with B5.5 (see below).

For transfecting BSp73AS-ß4 cells with D6.1A cDNA, pcDNA3-D6.1A and pKEX-2XR were digested with EcoRI and XbaI, blunted with Klenow fragment and digested again using NotI. Transfection was done by electroporation.

Immunoprecipitation
Cells (5x10⁶) were lysed in ice-cold lysis buffer (25 mM Hepes, 100 mM NaCl; 1 mM CaCl₂, 1 mM MgCl₂, pH 7.2) containing 1% CHAPS. Lysis was performed for 1 or 4 hours at 4°C. Lysis buffers contained a protease inhibitor cocktail (Boehringer Mannheim). After centrifugation for 30 minutes at 13000 rpm cell lysates were subjected to immunoprecipitation.

Lysates were precleared by the addition of 10 µg/ml control antibody for 60 minutes followed by incubation with 1/10 volume protein G Sepharose for 2 hours at 4°C. Precleared lysates were incubated for 60 minutes at 4°C with 2 µg of antibody or control IgG. Protein G Sepharose was added for an additional 60 minutes. Immune complexes were washed 4-6 times with lysis buffer. Immunoprecipitated proteins were analyzed by SDS-PAGE, followed by Western blotting.

Western blotting
Lysates were resolved on 10-12% SDS-PAGE under reducing or non-reducing conditions and the proteins were transferred to Immobilon P at 90 V for 90 minutes. After blocking the membranes with 3% BSA, immunoblotting was performed by using the indicated antibodies, followed by donkey anti-mouse-HRP or donkey anti-rabbit-HRP. Blots were developed with the enhanced chemiluminescence detection system.

Cell spreading, adhesion, migration and proliferation
Cell spreading was induced by seeding the tumor cells (1x10⁵/ml in RPMI 1640, 10% FCS) in Petri dishes or on cover slides, which had been precoated with Col IV or Fn or recombinant Ln5 or supernatant of the 804G cell line, which contains Ln5. Cells were incubated at 37°C for various times. Spreading was analyzed by light microscopy.

In adhesion assays, cells were incubated with [³H]thymidine for 16 hours. Cells were washed and seeded in triplicates on substrate-coated flat-bottom 96-well plates. Cells were incubated for 20-120 minutes. Plates were washed vigorously. The remaining adherent cells were detached by incubation in 0.2% trypsin. Plates were harvested using an automatic harvester and were counted in a ß-counter. Where indicated, 10 µg/ml antibodies were added during incubation.

Cell migration was evaluated using a modification of the scratch assay. Petri dishes were coated with substrates as described above. Thereafter, the central area of the Petri dishes was covered with a cover slide (6 mm diameter). Tumor cells were seeded on substrate-coated Petri dishes in RPMI supplemented with 10% FCS. Upon reaching subconfluency, the cover slide was removed. Medium was sucked off, plates were washed to remove non-adherent cells and RPMI supplemented with 1% FCS and, where indicated, 10 µg/ml antibodies were added. Plates were incubated for 72 hours, washed, fixed and stained with Hematoxylin-Eosin. Mean values and standard deviations of the number of cells migrating in the originally cell-free area were evaluated by counting 10 fields of 1 mm² directly at the boundary towards the originally cell-free area using an inverted microscope at 24, 48 and 72 hours after removal of the cover slide. Fast migrating cells were evaluated by counting cells in the central area of the removed cover slide. Values represent the mean of 3 independently performed experiments.

Proliferative activity was determined by [³H]thymidine incorporation (10 µCi/ml) after seeding 10⁴ tumor cells in triplicates in 96-well flat-bottom plates and incubation for 8 hours at 37°C. Thereafter cells were centrifuged, medium was discarded and adherent cells were detached by trypsin treatment. Cells were harvested and [³H]thymidine incorporation was determined as described above.

Metastasis assay
Tumor cells (2x10⁵) were injected either intrafootpad (i.f.p.) or intraperitoneally (i.p.). When tumors in the footpad reached a mean diameter of 0.5 cm, they were excised (Animal license 089/98). Animals were regularly controlled for the development of lymph node metastases and a palpable mass in the peritoneal cavity. Animals were sacrificed and analyzed macroscopically for the presence of metastases when they became anemic, short breathing or lost weight, or when a palpable mass in the peritoneal cavity or in lymph nodes reached a mean diameter of 2-3 cm.

Statistics
Significance of differences was evaluated using the two-tailed Student's t-test.

	Results

Top Summary Introduction Materials and Methods Results Discussion References

 
Cloning of the rat 6 integrin chain
The mAb B5.5 recognizes a surface molecule on metastasizing rat tumor lines. Since attempts to clone the molecule by screening of an expression library of a metastasizing rat tumor line (Regressor) failed, we speculated that B5.5 may recognize a conformational epitope (see below). Hence, we isolated the molecule by affinity chromatography and used mass spectrometry for its identification.

Lysates of the metastasizing tumor line Progressor were loaded on a B5.5-coated Sepharose 4B column. Eluates were run on SDS-PAGE and showed two bands of 130 kDa and 200 kDa (Fig. 1A). Bands were cut out, digested with trypsin, and peptides were subjected to mass spectrometry. The 200 kDa band revealed 26 peaks, of which 18 matched the rat ß4 integrin chain. From the rat 6 integrin cDNA only two short fragments were known. Yet, the 130 kDa band revealed 29 peptides, of which 16 matched the murine 6 integrin chain, suggesting the 130 kDa band to be the rat 6 integrin.

View larger version (53K): [in this window] [in a new window]   Fig. 1. Identification of rat 6ß4. (A) Lysate of Progressor cells was purified by immunoaffinity chromatography and separated by SDS-PAGE, which revealed two bands of 130 and 200 kDa. The trypsin digest of these 2 bands was subjected to mass spectrometry. (B) PCR analysis of the metastasizing lines BSp73ASML, Progressor and Regressor and of the non-metastasizing line BSp73AS with primers (see Materials and Methods) detecting the 7 AS deletion (ß4D) (left) and the +53 and/or +70 insertion (ß4B/ß4C) (right) of the ß4 integrin. The 3 metastasizing lines express the ß4A isoform. The non-metastasizing line does not express the ß4 integrin. (C) Staining of BSp73ASML, BSp73AS and BSp73AS-ß4 cells confirms that B5.5 recognizes 6ß4. Black line: negative control (secondary antibody), light gray area: staining with B5.5, dark gray area: staining with anti-ß1. Single parameter overlays are shown.

Two known rat 6 integrin cDNA fragments, ETS AA955091 and a 265 bp fragment, were obtained from the German Resource Center, Berlin, Germany, and from L. Feltri, Institute San Rafaele, Milano, Italy (Feltri et al., 1997). Primers designed from these fragments were used in combination with pcDNA3-specific primers to amplify the 5' and 3' ends of the 6 cDNA from the above mentioned library of the Regressor line (see Materials and Methods). The 5' end of the gene was not present in the library and was cloned from 804G cells (see Materials and Methods). The full-length cDNA of the 6 integrin chain was sequenced (accession no. AJJ12933 and AJJ12934). The rat 6 integrin chain shows 94% and 86% identity to mouse and human cDNA, respectively. The homology at the protein level is 96% to mouse and 89% to human 6 (Fig. 2).

View larger version (39K): [in this window] [in a new window]   Fig. 2. Comparison of the amino acid sequences of rat (R), mouse (M) and human (H) 6 integrin chain. Identical amino acids (aa) are indicated by a dash, conserved aa are in bold and are highlighted in gray and semi-conserved aa are in bold. Alignments and comparison of substituted aa were performed using the ClustalW from EMBL-EBI. The extracellular domain including the three beta propellar repeats, the transmembrane and cytoplasmic domains are indicated by a vertical line. Peptides identified by mass spectrometry are highlighted in gray.

Expression of ß4 in the tumor line from which the extracts were derived and in two additional metastasizing lines was verified by PCR. Primers for the PCR (see Materials and Methods) had been chosen such that splice variants of the ß4 chain would have become apparent. All three metastasizing lines expressed the ß4A isoform (DeMelker and Sonnenberg, 1999). The ß4 integrin was not expressed by BSp73AS, a non-metastasizing subline of BSp73 (Fig. 1B).

To prove that the mAb B5.5 recognizes 6ß4, the non-metastasizing BSp73AS line was transfected with the ß4 cDNA. BSp73AS cells are not recognized by B5.5, but express 6ß1, which implies that B5.5 does not recognize 6. After transfection of BSp73AS cells with ß4 cDNA several clones were obtained that were stained by B5.5 (Fig. 1C). Expression of ß1 was reduced in BSp73AS-ß4 clones. This might be due to the efficient association of ß4 with 6, a phenomenon already described (Shaw et al., 1996). It should be mentioned that the staining of BSp73AS-ß4 cells with B5.5 does not allow any prediction on the binding epitope because ß4 is only expressed in association with 6. Hence, B5.5 might recognize an epitope on ß4 or an epitope made up by 6 and ß4.

Expression of 6ß4 on the non-metastasizing BSp73AS line
Functional activity of 6ß4 was first explored in BSp73AS cells transfected with ß4 cDNA. Expression of 6ß4 on BSp73AS cells was accompanied by a change in cell shape. The epitheloid-like BSp73AS cells became spindle shaped, and staining of the actin cytoskeleton revealed the formation of stress fibers (Fig. 3A).

View larger version (78K): [in this window] [in a new window]   Fig. 3. Morphology, substrate adhesion and motility of BSp73AS-ß4 cells. (A) BSp73AS and BSp73AS-ß4 cells were grown on plastic culture dishes and were stained with Phalloidin-TRITC. As compared to the epitheloid BSp3AS cells, BSp73AS-ß4 cells resembled spindle shaped fibroblasts. Scale bar: 1.7 µm. (B) BSp73AS, BSp73AS-ß4, BSp73ASML and Progessor cells were labeled with [3H]thymidine and were seeded in triplicates on plates coated with BSA, recombinant Ln5, Col IV or Fn. After 20 minutes or 2 hours incubation, plates were vigorously washed. Adherent cells were detached and harvested. Radioactivity was determined in a ß-counter. The percentage (±s.d.) of adherent cells is shown. A significant increase in adhesion to the substrates as compared to BSA is indicated by an asterisk. Similar results have been obtained in repeated experiments using 804G supernatant as a source of Ln5. (C) BSp73AS, BSp73AS-ß4 and Progessor cells were seeded on recombinant Ln5-coated Petri dishes, where the central area was protected by a cover slide. After reaching subconfluency, the cover slide was removed. Thereafter medium was changed with the fresh medium contained only 1% FCS and either a control antibody, or B5.5 (10 µg/ml). After 72 hours, cultures were washed, cells were fixed and stained with Hematoxylin-Eosin. Pictures were taken at the boundary from where cells started to migrate (proximal) as well as from the center of the area initially protected by a cover slide (distant). Scale bar: 0.5 µm.

However, expression of 6ß4 in BSp73AS cells had no impact on metastasis formation after intrafootpad tumor cell application (data not shown). Also, the change in cell shape was not accompanied by altered adhesion to either plastic, Fn or Col IV. Adhesion to Ln5, the major ligand of 6ß4, was only slightly improved as compared to BSp73AS cells and only after a short incubation period. However, the metastasizing lines adhered better to Ln5 than to plastic (Fig. 3B). Also, 6ß4 expression on BSp73AS cells had no impact on migration on Ln5. However, in the presence of B5.5, migration of BSp73AS-ß4 cells was slightly improved. The metastasizing Progressor cells readily migrated on Ln5-coated plates. Particularly at later time points, the migratory capacity on Ln5 was strengthened in the presence of B5.5 (Fig. 3C, Table 1). Thus, the question arose of why expression of 6ß4 on BSp73AS-ß4 cells, distinct from BSp73ASML and Progressor cells, had little bearing on adhesion to and migration on Ln5.

Co-localization of 6ß4 with the tetraspanin D6.1A
Because expression of 6ß4 on BSp73AS-ß4 cells had no impact on metastasis formation or adhesion to Ln5, we speculated that in metastasizing lines 6ß4 may exert functional activity in concert with additional molecules not present in the non-metastatic BSp73AS line. We first evaluated by antibody cross-linking whether 6ß4 would co-cluster with additional molecules highly overexpressed on metastasizing tumors. Cells were seeded on cover slides and allowed to adhere overnight. Thereafter, cells were incubated with either A2.6 (anti-CD44v6), C4.4 (recognizing the uPAR-related molecule C4.4A), D6.1 (recognizing the tetraspanin D6.1A), D5.7 (anti-EpCAM) or anti-CD9. Bound antibodies were cross-linked with an excess of FITC-labeled anti-mIgG. Thereafter, cells were washed and fixed. Free binding sites of FITC-labeled anti-mouse IgG were blocked by incubation with an excess of unlabeled mouse IgG. Cells were then stained with TxR-labeled B5.5. In fact, cross-linking of CD44v6 and of the tetraspanin D6.1A was associated with coclustering of 6ß4 on BSp73ASML (data not shown) and Progressor cells. Very few 6ß4 molecules were detected in clusters of EpCAM (D5.7A) or the uPAR-related molecule C4.4A. Interestingly, 6ß4 also hardly co-clustered with the tetraspanin CD9 (Fig. 4,Fig. 4). In contrast, after cross-linking of 6ß4, CD44v6 and D6.1A, but not EpCAM or C4.4A co-clustered with 6ß4. However, it should be mentioned that a considerable amount of D6.1A was not detected in 6ß4 clusters (data not shown).

View larger version (101K): [in this window] [in a new window]   Fig. 4. Co-clustering of 6ß4 with D6.1A. (A) Progressor cells were incubated for 15 minutes at 37°C with A2.6, C4.4, D6.1, D5.7 (all of which recognize metastasis-associated molecules), anti-CD9 (expressed on Progressor cells) and, as a negative control, anti-CD18 (not expressed on Progressor cells). Cells were washed with cold PBS and were incubated for 20 minutes at 37°C with an excess of FITC-labeled anti-mIgG. Thereafter cells were immediately transferred on ice. After washing and fixation, free binding sites of FITC-labeled anti-mIgG were blocked by incubation with PBS containing 10 µg/ml mouse IgG. Finally, cells were stained with B5.5-TxR (1 hour, 4°C), the staining solution also containing mIgG to avoid unspecific binding of B5.5-TxR to the FITC-labeled anti-mIgG. (B) Progressor cells were mixed with BSp73AS-D6.1A (indicated by one asterisk) that express the D6.1A tetraspanin, or BSp73AS-ß4 cells (indicated by two asterisks) that express 6ß4. As described in A, cells were stained with D6.1/anti-mIgG-FITC and B5.5-TxR or with B5.5/anti-mIgG-FITC and D6.1-TxR. Single stainings and overlays of green and red fluorescence are shown. The FITC-labeled anti-mIgG does not bind unspecifically (anti-CD18 staining) and B5.5-TxR or D6.1-TxR does not bind to FITC-labeled anti-mIgG that was blocked by mIgG (staining of the mixture of Progressor and BSp73AS-D6.1A or BSp73AS-ß4 cells). Although Progressor cells express CD44v6, C4.4A, D6.1A and D5.7A at a comparably high level, 6ß4 co-clustered only with CD44v6 (A2.6) and D6.1A. Scale bar: (A) 10 µm; (B) 5 µm.

View larger version (71K): [in this window] [in a new window]   Fig. 4. Co-clustering of 6ß4 with D6.1A. (A) Progressor cells were incubated for 15 minutes at 37°C with A2.6, C4.4, D6.1, D5.7 (all of which recognize metastasis-associated molecules), anti-CD9 (expressed on Progressor cells) and, as a negative control, anti-CD18 (not expressed on Progressor cells). Cells were washed with cold PBS and were incubated for 20 minutes at 37°C with an excess of FITC-labeled anti-mIgG. Thereafter cells were immediately transferred on ice. After washing and fixation, free binding sites of FITC-labeled anti-mIgG were blocked by incubation with PBS containing 10 µg/ml mouse IgG. Finally, cells were stained with B5.5-TxR (1 hour, 4°C), the staining solution also containing mIgG to avoid unspecific binding of B5.5-TxR to the FITC-labeled anti-mIgG. (B) Progressor cells were mixed with BSp73AS-D6.1A (indicated by one asterisk) that express the D6.1A tetraspanin, or BSp73AS-ß4 cells (indicated by two asterisks) that express 6ß4. As described in A, cells were stained with D6.1/anti-mIgG-FITC and B5.5-TxR or with B5.5/anti-mIgG-FITC and D6.1-TxR. Single stainings and overlays of green and red fluorescence are shown. The FITC-labeled anti-mIgG does not bind unspecifically (anti-CD18 staining) and B5.5-TxR or D6.1-TxR does not bind to FITC-labeled anti-mIgG that was blocked by mIgG (staining of the mixture of Progressor and BSp73AS-D6.1A or BSp73AS-ß4 cells). Although Progressor cells express CD44v6, C4.4A, D6.1A and D5.7A at a comparably high level, 6ß4 co-clustered only with CD44v6 (A2.6) and D6.1A. Scale bar: (A) 10 µm; (B) 5 µm.

Because tetraspanins associate in particular with integrins (reviewed by Maecker et al., 1997), we focussed on the co-localization of 6ß4 and D6.1A. These studies were performed with metastasizing lines and BSp73AS cells transfected with ß4 and D6.1A cDNA (BSp73AS-db). Several BSp73AS-db clones were established. The integrin and tetraspanin expression profile of one characteristic clone in comparison to BSp73AS, BSp73AS-ß4, BSp73AS-D6.1 and the metastasizing lines BSp73ASML, Progressor and 804G is listed in Table 2. All lines express 3, 6 and ß1 at a high level. Only the metastasizing lines (and transfected lines) express 2 and ß4. With the exception of a downregulation of ß1 in BSp73AS-ß4 cells and a slight upregulation of 3 in BSp73AS-db cells, transfection of the non-metastasizing line with ß4 and D6.1A cDNA did not influence integrin expression. Only the metastasizing lines (and by transfection the BSp73AS-D6.1A, BSp73AS-db lines) express the tetraspanin D6.1A. But, all lines express the tetraspanins CD151 (unpublished finding) and CD9.

To test, whether D6.1A and 6ß4 also co-localize in the BSp73AS-db line, cells were seeded on Ln5-coated cover slides and were allowed to spread for 48 hours before staining with B5.5/anti-mIgG-FITC and D6.1-TxR or D6.1/anti-mIgG-FITC or anti-CD9/anti-mIgG-FITC and B5.5-TxR. In BSp73AS-db cells, 6ß4 mostly co-localized with D6.1A. D6.1A also co-localized with 6ß4, although a considerable proportion of D6.1A was seen outside of 6ß4 clusters. Only very few 6ß4 molecules co-localized with CD9 (Fig. 5).

View larger version (93K): [in this window] [in a new window]   Fig. 5. Co-localization of 6ß4 and D6.1A in BSp73AS-db cells. BSp73AS-db cells were seeded on recombinant Ln5. After 48 hours cells were stained with D6.1 or anti-CD9 plus FITC-labeled anti-mIgG and were counterstained with TxR-labeled B5.5 or were stained with B5.5 plus FITC-labeled anti-mIgG and were counterstained with TxR-labeled D6.1. As described in Fig. 4,Fig. 4, binding of the second, dye-labeled antibody to anti-mouse IgG was prevented by the addition of an excess of mouse IgG. Red and green fluorescence and the digital overlay are shown. Whereas in BSp73AS-db cells D6.1A and 6ß4 mostly co-localized irrespective of whether D6.1A or 6ß4 was cross-linked via the secondary antibody, CD9 hardly co-localized with 6ß4. Scale bar: 10 µm.

We next tested whether co-localization of D6.1A and 6ß4 could be verified by co-immunoprecipitation. Progressor cells were lysed for 1 hour at 4°C in the mild detergent CHAPS. Lysates were precipitated with anti-ß4, anti-3, anti-ß1 and D6.1 and were blotted with D6.1. D6.1A clearly co-precipitated with ß4 and also with 3 and ß1, which has been shown before (Claas et al., 1998) (Fig. 6A). To control for the specificity of co-precipitation, Progressor cells were biotinylated and precipitated with C4.4 (anti-C4.4A <uPAR-related>), D5.7 (anti-EpCAM), Ox50 (anti-panCD44), anti-CD9, anti-ß4, anti-6, B5.5, D6.1 and A8.10. CD44, EpCAM and C4.4A are highly expressed on metastasizing lines. mAb A8.10, which recognizes a molecule only detected on BSp73AS cells, served as a negative control. After gel separation, all precipitates were blotted with streptavidin, D6.1 and anti-CD9. D6.1A co-precipitated with 6ß4 (B5.5), ß4 and CD9. Smaller amounts of D6.1A were recovered in the 6 and the CD44 precipitate. It should be mentioned that Progressor cells hardly express the CD44 standard isoform, but large amount of CD44v6, i.e. small amounts of D6.1A co-precipitate with CD44 variant isoforms. There was a very faint co-precipitate with D5.7A (EpCAM), but none with C4.4A and with the control antibody A8.10. A different picture emerged when the precipitates were blotted with anti-CD9. CD9 was only recovered in D6.1 and anti-CD9 precipitates (Fig. 6B). Notably, 6ß4 and D6.1A did not co-immunoprecipitate after lysis in strong detergents like Triton X-100, which argues against a direct association of the two molecules (data not shown).

View larger version (61K): [in this window] [in a new window]   Fig. 6. Co-immunoprecipitation of 6ß4 and D6.1A. (A) Lysates of Progressor cells were precipitated with B5.5, anti-ß4, anti-3, anti-ß1 and D6.1. After gel separation and transfer, membranes were stained with D6.1. (B) Lysates of biotinylated Progressor cells were immunoprecipitated with C4.4 (anti-C4.4A), D5.7 (anti-EpCAM), Ox50 (anti-panCD44), anti-CD9, anti-ß4, anti-6, B5.5, D6.1 and A8.10 (non-binding antibody). After gel separation and transfer, membranes were stained with streptavidin, D6.1 and anti-CD9. A large amount of D6.1A was recovered in D6.1-, anti-CD9-, anti-6 and anti-3 precipitates. D6.1A was also precipitated by B5.5, anti-ß4 and anti-ß1. Small amounts of D6.1A were recovered in precipitates with Ox50 and D5.7. No D6.1A was recovered in C4.4 and A8.10 precipitates. CD9 was only recovered in anti-CD9 and D6.1 precipitates.

Since the B5.5 and the anti-ß4 precipitates contained only part of D6.1A, the specificity of co-precipitation of the two molecules was controlled by several means. First, using lysates of Progressor cells (CHAPS, 4 hours, 4°C) the ß4 could be re-precipitated from precipitates with B5.5 or D6.1 but not Ox50 or A8.10, although high amounts of precipitate were required to reach the detection limit. Second, when mixing BSp73AS-D6.1A and BSp73AS-ß4 cells, the B5.5 precipitate of the lysate (CHAPS, 4 hours, 4°C) did not contain D6.1A. Yet, it did so when BSp73AS-db cells were lysed (data not shown).

Thus, a small proportion of 6ß4 and D6.1A can be co-precipitated when using mild detergent. To obtain further information on the conditions for this association, we compared co-localization of the two molecules by immunofluorescence microscopy under resting and stimulatory conditions.

Non-random co-localization and redistribution of 6ß4 and D6.1A after PKC activation
PKC was described to regulate integrin-dependent cell motility (Ng et al., 1999) and to facilitate cell migration (Maniero et al., 1996). Also, the motility of keratinocytes was modulated when 6ß4 associated with CD9 (Baudoux et al., 2000). Thus, it became of interest to determine whether PKC activation would be accompanied by changes in co-localization of 6ß4 and D6.1A. The distribution/co-distribution of 6ß4 and D6.1A was evaluated by immunofluorescence in metastatic lines and BSp73AS-db cells. Cells were seeded on Ln5-coated cover slides and were allowed to spread for 48 hours. Thereafter cells were treated for 30 minutes to 2 hours with PMA. Cells were fixed and permeabilized for between 30 minutes and 10 hours after PMA addition. Cell were stained immediately after fixation and permeabilized with either phalloidin-TRITC or were stained with D6.1 or anti-CD9 and were counterstained with B5.5.

PMA treatment was accompanied by changes in the actin cytoskeleton. Growing actin bundles were already seen 1 hour after PMA addition in BSp73AS-db cells. Cells developed long filipodia and spikes. Later on, actin bundles were seen at the front of the leading lamella. Long actin fibres were no longer seen 10 hours after PMA treatment, but organization in fibres was still more pronounced than in untreated cells. Although actin bundle formation was not seen in PMA-treated Progressor cells, the actin distribution clearly changed after PMA treatment. The equal distribution seen in untreated cells was lost, actin was enriched in filipodia and later on it clustered in the body of the cells. From there it moved towards the leading lamella. At 6 hours after PMA treatment actin was strongly enriched in the leading lamella and at 10 hours after PMA treatment at the front of the leading lamella (Fig. 7A).

View larger version (99K): [in this window] [in a new window]   Fig. 7. Redistribution of D6.1A and 6ß4 during and after PMA treatment. (A,B) Progressor and BSp73AS-db cells were seeded on Ln5 (A and B2, recombinant Ln5; B1, 804G supernatant). After overnight adhesion, cells were treated for 1 to 2 hours with PMA (10–8 M). Untreated cells and PMA-treated cells were washed, fixed and permeabilized and were stained (immediately after fixation and permeabilization) with (A) phalloidin-TRITC, (B1) D6.1-FITC and B5.5-TxR or (B2) anti-CD9/anti-mIgG-FITC and B5.5-TxR. Single stainings and digital overlays are shown. (A) BSp73AS-db and Progressor cells were treated for 1 hour (BSp73AS-db) or 2 hours (Progressor) with PMA and were stained with phalloidin-TRITC at the indicated times after starting PMA treatment. In BSp73AS-db cells actin became organized in strong, growing bundles (open arrow). Later, the thin and partly very long filipodia (arrow; 4-5 hours) and the front of the leading lamella (arrowhead; 6 hours) were stained by phalloidin. After 10 hours adjacent cells were connected via thin filipodia (open arrowhead). Although less pronounced, actin bundles are still visible. Actin bundle formation was not seen in PMA-treated Progressor cells. However, actin was redistributed, being first enriched in filipodia (arrow) and thereafter in clusters in the body of the cells (open arrow). After 6 hours, actin increased at the base (arrowhead) and after 10 hours at the front of the leading lamella (open arrow head). Scale bar: 10 µm. (B1) During PMA treatment Progressor cells develop long filipodia, which were stained by B5.5 and D6.1 (closed arrow). Early in the recovery period, double staining was mainly seen intracellularly (open arrow); The leading lamella was hardly stained (arrowhead). After 10 hours the leading lamella was brightly stained by B5.5 and D6.1 (arrowhead). Scale bar: 10 µm. (B2) CD9 became very rapidly internalized during PMA treatment (arrow) and apparently co-localized with 6ß4 (open arrow). After 4 and 8 hours CD9 mostly was still found in large intracellular clusters (vesicles) (arrowhead). After 10 hours the leading lamella was brightly stained by B5.5 and faintly by anti-CD9 (open arrowhead). But, 6ß4 only rarely co-localized with CD9. Scale bar: 10 µm. (C) D6.1A-EYFP-transfected 804G cells were seeded on Ln5 (804G supernatant)-coated cover slides and were stained with B5.5 and TxR-labeled anti-mIgG. Top row: Resting 804G cells showing very little co-localization of D6.1A and 6ß4, and where present only in spikes. Scale bar: 20 µm. Middle rows: Co-localization of 6ß4 and D6.1A is readily seen after 30 minutes of PMA treatment (left). After 2 hours PMA treatment, cells developed long filipodia. Co-localization of D6.1A and 6ß4 is mainly seen intracellularly as depicted by the sagittal section through the filipodium of the above shown cell. Scale bars: 20 µm, sagittal section: 14 µm. Lower row: The migratory phenotype of PMA-treated 804G cells becomes most obvious when seeded at low density. Two hours after PMA treatment, cells were stained with B5.5 and TxR-labeled anti-mIgG. Two hours after PMA treatment, 6ß4 is enriched in the trail and the lagging edge of the cell, whereas the large lamelipodium is mostly devoid of the integrin. Left and right show the same cells, the brighter picture being included to demonstrate the formation of extended lamellae (arrow).

D6.1A and 6ß4 were more or less equally distributed after spreading of Progressor cells on Ln5 (Fig. 6B₁). This accounted also for BSp73ASML and BSp73AS-db cells (data not shown). During PMA treatment, Progressor cells developed long filipodia, which were strongly stained by B5.5 and D6.1, whereas the body of the cells became almost devoid of integrin and tetraspanin. After PMA removal, the tetraspanin and 6ß4 were transiently seen in the body of the cells (4 and 6 hours). Ten hours after PMA treatment, lamellae were brightly stained by B5.5 and D6.1. The apparent internalization was not restricted to 6ß4 and D6.1A. Membrane staining of EpCAM was strongly reduced (data not shown) and CD9 rapidly and completely disappeared from the cell membrane. CD9 became strongly enriched in intracellular bodies for up to 8 hours. When PMA-treated and permeabilized Progressor cells were stained with anti-CD9 and B5.5, yellow areas were seen in digital overlays, which could indicate co-localization of CD9 and 6ß4. B5.5 staining of the leading lamella was more pronounced at 10 hours than at 8 hours after PMA treatment. At 10 hours after PMA treatment, CD9 had also reached the front of the leading lamella, however, 6ß4 and CD9 did not generally co-localize at the migratory front of the cells (Fig. 7B₂). EpCAM became equally redistributed in the cell membrane and there was no evidence for a selective co-distribution of EpCAM and the 6ß4 integrin (data not shown).

View larger version (97K): [in this window] [in a new window]   Fig. 7. Redistribution of D6.1A and 6ß4 during and after PMA treatment. (A,B) Progressor and BSp73AS-db cells were seeded on Ln5 (A and B2, recombinant Ln5; B1, 804G supernatant). After overnight adhesion, cells were treated for 1 to 2 hours with PMA (10–8 M). Untreated cells and PMA-treated cells were washed, fixed and permeabilized and were stained (immediately after fixation and permeabilization) with (A) phalloidin-TRITC, (B1) D6.1-FITC and B5.5-TxR or (B2) anti-CD9/anti-mIgG-FITC and B5.5-TxR. Single stainings and digital overlays are shown. (A) BSp73AS-db and Progressor cells were treated for 1 hour (BSp73AS-db) or 2 hours (Progressor) with PMA and were stained with phalloidin-TRITC at the indicated times after starting PMA treatment. In BSp73AS-db cells actin became organized in strong, growing bundles (open arrow). Later, the thin and partly very long filipodia (arrow; 4-5 hours) and the front of the leading lamella (arrowhead; 6 hours) were stained by phalloidin. After 10 hours adjacent cells were connected via thin filipodia (open arrowhead). Although less pronounced, actin bundles are still visible. Actin bundle formation was not seen in PMA-treated Progressor cells. However, actin was redistributed, being first enriched in filipodia (arrow) and thereafter in clusters in the body of the cells (open arrow). After 6 hours, actin increased at the base (arrowhead) and after 10 hours at the front of the leading lamella (open arrow head). Scale bar: 10 µm. (B1) During PMA treatment Progressor cells develop long filipodia, which were stained by B5.5 and D6.1 (closed arrow). Early in the recovery period, double staining was mainly seen intracellularly (open arrow); The leading lamella was hardly stained (arrowhead). After 10 hours the leading lamella was brightly stained by B5.5 and D6.1 (arrowhead). Scale bar: 10 µm. (B2) CD9 became very rapidly internalized during PMA treatment (arrow) and apparently co-localized with 6ß4 (open arrow). After 4 and 8 hours CD9 mostly was still found in large intracellular clusters (vesicles) (arrowhead). After 10 hours the leading lamella was brightly stained by B5.5 and faintly by anti-CD9 (open arrowhead). But, 6ß4 only rarely co-localized with CD9. Scale bar: 10 µm. (C) D6.1A-EYFP-transfected 804G cells were seeded on Ln5 (804G supernatant)-coated cover slides and were stained with B5.5 and TxR-labeled anti-mIgG. Top row: Resting 804G cells showing very little co-localization of D6.1A and 6ß4, and where present only in spikes. Scale bar: 20 µm. Middle rows: Co-localization of 6ß4 and D6.1A is readily seen after 30 minutes of PMA treatment (left). After 2 hours PMA treatment, cells developed long filipodia. Co-localization of D6.1A and 6ß4 is mainly seen intracellularly as depicted by the sagittal section through the filipodium of the above shown cell. Scale bars: 20 µm, sagittal section: 14 µm. Lower row: The migratory phenotype of PMA-treated 804G cells becomes most obvious when seeded at low density. Two hours after PMA treatment, cells were stained with B5.5 and TxR-labeled anti-mIgG. Two hours after PMA treatment, 6ß4 is enriched in the trail and the lagging edge of the cell, whereas the large lamelipodium is mostly devoid of the integrin. Left and right show the same cells, the brighter picture being included to demonstrate the formation of extended lamellae (arrow).

A similar redistribution of a6ß4 and D6.1A as described for Progressor cells was seen in BSp73ASML and BSp73AS cells. BSp73ASML cells, which appear round and `unstructured' developed protrusions and lamellae. Protrusions and lamellae were first largely devoid of the integrin and the tetraspanin, which were concentrated intracellularly. Already 6 hours after PMA treatment, lamellae were stained by B5.5 and D6.1. In PMA-treated BSp73AS-db cells co-localization of the integrin and the tetraspanin was mainly seen in spikes and filipodia. Later on, both molecules disappeared from the cell surface and co-localization in the leading lamella was seen only after 10 hours (data not shown).

The redistribution of 6ß4 and D6.1A after PMA treatment was also seen in 804G cells, which were transiently transfected with D6.1A-EYFP cDNA. In the resting state, only a very minor part of D6.1A and 6ß4 co-localized in filipodia. After 30 minutes PMA treatment D6.1A and 6ß4 readily colocalized. After 2 hours of treatment, cells started to migrate with long filipodia at the trailing edge, which was strongly stained by B5.5. D6.1A co-localized with 6ß4 in the trailing edge and in the main body of the cell. As revealed by confocal microscopy at the level of adhesion and 1 µm above (data not shown) and by a sagittal section, the 6ß4-D6.1A complexes forming after PMA treatment were found intracellularly (Fig. 7C). Evidence for cell migration (traces left behind by 6ß4-containing filipodia) (data not shown). Unlike Progressor cells, extension of lamellae could already be seen 2 hours after PMA treatment in 804G cells, at which time the leading lamellae were still mainly devoid of 6ß4.

View larger version (85K): [in this window] [in a new window]   Fig. 7. Redistribution of D6.1A and 6ß4 during and after PMA treatment. (A,B) Progressor and BSp73AS-db cells were seeded on Ln5 (A and B2, recombinant Ln5; B1, 804G supernatant). After overnight adhesion, cells were treated for 1 to 2 hours with PMA (10–8 M). Untreated cells and PMA-treated cells were washed, fixed and permeabilized and were stained (immediately after fixation and permeabilization) with (A) phalloidin-TRITC, (B1) D6.1-FITC and B5.5-TxR or (B2) anti-CD9/anti-mIgG-FITC and B5.5-TxR. Single stainings and digital overlays are shown. (A) BSp73AS-db and Progressor cells were treated for 1 hour (BSp73AS-db) or 2 hours (Progressor) with PMA and were stained with phalloidin-TRITC at the indicated times after starting PMA treatment. In BSp73AS-db cells actin became organized in strong, growing bundles (open arrow). Later, the thin and partly very long filipodia (arrow; 4-5 hours) and the front of the leading lamella (arrowhead; 6 hours) were stained by phalloidin. After 10 hours adjacent cells were connected via thin filipodia (open arrowhead). Although less pronounced, actin bundles are still visible. Actin bundle formation was not seen in PMA-treated Progressor cells. However, actin was redistributed, being first enriched in filipodia (arrow) and thereafter in clusters in the body of the cells (open arrow). After 6 hours, actin increased at the base (arrowhead) and after 10 hours at the front of the leading lamella (open arrow head). Scale bar: 10 µm. (B1) During PMA treatment Progressor cells develop long filipodia, which were stained by B5.5 and D6.1 (closed arrow). Early in the recovery period, double staining was mainly seen intracellularly (open arrow); The leading lamella was hardly stained (arrowhead). After 10 hours the leading lamella was brightly stained by B5.5 and D6.1 (arrowhead). Scale bar: 10 µm. (B2) CD9 became very rapidly internalized during PMA treatment (arrow) and apparently co-localized with 6ß4 (open arrow). After 4 and 8 hours CD9 mostly was still found in large intracellular clusters (vesicles) (arrowhead). After 10 hours the leading lamella was brightly stained by B5.5 and faintly by anti-CD9 (open arrowhead). But, 6ß4 only rarely co-localized with CD9. Scale bar: 10 µm. (C) D6.1A-EYFP-transfected 804G cells were seeded on Ln5 (804G supernatant)-coated cover slides and were stained with B5.5 and TxR-labeled anti-mIgG. Top row: Resting 804G cells showing very little co-localization of D6.1A and 6ß4, and where present only in spikes. Scale bar: 20 µm. Middle rows: Co-localization of 6ß4 and D6.1A is readily seen after 30 minutes of PMA treatment (left). After 2 hours PMA treatment, cells developed long filipodia. Co-localization of D6.1A and 6ß4 is mainly seen intracellularly as depicted by the sagittal section through the filipodium of the above shown cell. Scale bars: 20 µm, sagittal section: 14 µm. Lower row: The migratory phenotype of PMA-treated 804G cells becomes most obvious when seeded at low density. Two hours after PMA treatment, cells were stained with B5.5 and TxR-labeled anti-mIgG. Two hours after PMA treatment, 6ß4 is enriched in the trail and the lagging edge of the cell, whereas the large lamelipodium is mostly devoid of the integrin. Left and right show the same cells, the brighter picture being included to demonstrate the formation of extended lamellae (arrow).

It was also of interest to see whether 6ß4 and D6.1A would re-distribute in PMA-treated BSp73AS cells expressing either 6ß4 or D6.1A. PMA-induced morphological changes of BSp73AS-D6.1A and BSp73AS-ß4 cells were less pronounced than of BSp73AS-db cells. Yet, it appeared that D6.1A was enriched intracellularly after PMA treatment even in the absence of 6ß4. BSp73AS-ß4 cells developed thin filipodia, which were transiently stained by B5.5. During the recovery period 6ß4 was mainly detected intracellularly. Notably, even 12 hours after PMA treatment, 6ß4 did not become enriched in filipodia, protrusions or lamellae as it was seen in Progressor, BSp73ASML and BSp73AS-db cells (data not shown).

Thus, PKC stimulation induced changes in morphology and was accompanied by a redistribution of 6ß4 and of 6ß4-D6.1A `complexes'. The redistribtion of 6ß4-D6.1A `complexes' started with a transient and co-ordinated `internalization' of the molecules. Internalization was also seen in BSp73AS-ß4 and BSp73AS-D6.1A cells and PMA-induced internalization was not restricted to 6ß4 and D6.1A, i.e. CD9 also became internalized. However, re-expression of 6ß4 in the leading lamella was only seen in metastasizing lines and BSp73AS-db cells and was accompanied by co-localization with D6.1A.

D6.1 interferes with functional activity of 6ß4
If our hypothesis holds true that the 6ß4-tetraspanin complex is involved in cell motility, blockade of D6.1A could possibly interfere with adhesive and migratory functions of 6ß4.

It has already been shown that expression of ß4 on BSp73AS cells hardly influenced binding to and migration on Ln5. The same was true for BSp73AS-D6.1A cells (data not shown). Yet, BSp73AS-db cells adhered significantly more strongly to Ln5 than to BSA. Because BSp73AS-db cells express 3 at a slightly increased level as compared to BSp73AS, we first determined whether the increased Ln5 binding could be 3 mediated. Ln5-binding of BSp73ASML, BSp73AS-db, and also of AS-ß4 and AS-D6.1 was slightly reduced in the presence of anti-3. Yet, even in the presence of anti-3, an increased percentage of BSp73AS-db adhered to Ln5-coated wells. Furthermore, B5.5 and D6.1, neither of which influenced adhesion of BSp73AS-ß4 and BSp73AS-D6.1A cells to plastic or Ln5, significantly inhibited adhesion of BSp73AS-db cells to Ln5. The same pattern of inhibition of adhesion, though less pronounced, was seen with BSp73ASML and Progressor cells (Fig. 8A). No uniform pattern of adhesion/inhibition of adhesion was seen in PMA-treated cells, which might be due to alteration in expression/configuration of additional adhesion molecules by PKC activation and also to the transient internalization of D6.1A and 6ß4 (data not shown).

View larger version (96K): [in this window] [in a new window]   Fig. 8. Influence of co-expession of 6ß4 and D6.1A on cell adhesion and migration. (A) BSp73AS-ß4, BSp73AS-D6.1A, BSp73AS-db, BSp73ASML and Progressor cells were labeled with [3H]thymidine and seeded on BSA- or recombinant Ln5-coated 96 well plates in the absence or presence of anti-3, B5.5 or D6.1 (10 µg/ml). After 2 hours, unbound cells were washed off, adherent cells were detached and were counted in a ß-counter. Mean cpm ± s.d. of triplicates are shown. Significant inhibition of binding by the antibodies is indicated by an asterisk. Binding of BSp73AS-ß4, BSp73AS-D6.1A, BSp73AS-db and BSp73ASML cells to Ln5 was slightly inhibited by anti-3. B5.5 and D6.1 only inhibited Ln5 binding of BSp73AS-db, BSp73ASML and Progressor cells. (B) BSp73AS, BSp73AS-ß4, BSp73AS-D6.1A, BSp73AS-db and Progressor cells were seeded on Petri dishes coated with recombinant Ln5, where the central area was protected by a cover slide. After reaching subconfluency, the cover slide was removed. Thereafter medium was changed, fresh medium containing only 1% FCS and, where indicated, PMA (10–8 M). After 72 hours, cultures were washed, cells were fixed and stained with Hematoxylin-Eosin. Pictures were taken at the boundary from where cells started to migrate (proximal) as well as from the center of the area initially protected by a cover slide (distant). Scale bar: 0.5 µm.

View larger version (86K): [in this window] [in a new window]   Fig. 7. Redistribution of D6.1A and 6ß4 during and after PMA treatment. (A,B) Progressor and BSp73AS-db cells were seeded on Ln5 (A and B2, recombinant Ln5; B1, 804G supernatant). After overnight adhesion, cells were treated for 1 to 2 hours with PMA (10–8 M). Untreated cells and PMA-treated cells were washed, fixed and permeabilized and were stained (immediately after fixation and permeabilization) with (A) phalloidin-TRITC, (B1) D6.1-FITC and B5.5-TxR or (B2) anti-CD9/anti-mIgG-FITC and B5.5-TxR. Single stainings and digital overlays are shown. (A) BSp73AS-db and Progressor cells were treated for 1 hour (BSp73AS-db) or 2 hours (Progressor) with PMA and were stained with phalloidin-TRITC at the indicated times after starting PMA treatment. In BSp73AS-db cells actin became organized in strong, growing bundles (open arrow). Later, the thin and partly very long filipodia (arrow; 4-5 hours) and the front of the leading lamella (arrowhead; 6 hours) were stained by phalloidin. After 10 hours adjacent cells were connected via thin filipodia (open arrowhead). Although less pronounced, actin bundles are still visible. Actin bundle formation was not seen in PMA-treated Progressor cells. However, actin was redistributed, being first enriched in filipodia (arrow) and thereafter in clusters in the body of the cells (open arrow). After 6 hours, actin increased at the base (arrowhead) and after 10 hours at the front of the leading lamella (open arrow head). Scale bar: 10 µm. (B1) During PMA treatment Progressor cells develop long filipodia, which were stained by B5.5 and D6.1 (closed arrow). Early in the recovery period, double staining was mainly seen intracellularly (open arrow); The leading lamella was hardly stained (arrowhead). After 10 hours the leading lamella was brightly stained by B5.5 and D6.1 (arrowhead). Scale bar: 10 µm. (B2) CD9 became very rapidly internalized during PMA treatment (arrow) and apparently co-localized with 6ß4 (open arrow). After 4 and 8 hours CD9 mostly was still found in large intracellular clusters (vesicles) (arrowhead). After 10 hours the leading lamella was brightly stained by B5.5 and faintly by anti-CD9 (open arrowhead). But, 6ß4 only rarely co-localized with CD9. Scale bar: 10 µm. (C) D6.1A-EYFP-transfected 804G cells were seeded on Ln5 (804G supernatant)-coated cover slides and were stained with B5.5 and TxR-labeled anti-mIgG. Top row: Resting 804G cells showing very little co-localization of D6.1A and 6ß4, and where present only in spikes. Scale bar: 20 µm. Middle rows: Co-localization of 6ß4 and D6.1A is readily seen after 30 minutes of PMA treatment (left). After 2 hours PMA treatment, cells developed long filipodia. Co-localization of D6.1A and 6ß4 is mainly seen intracellularly as depicted by the sagittal section through the filipodium of the above shown cell. Scale bars: 20 µm, sagittal section: 14 µm. Lower row: The migratory phenotype of PMA-treated 804G cells becomes most obvious when seeded at low density. Two hours after PMA treatment, cells were stained with B5.5 and TxR-labeled anti-mIgG. Two hours after PMA treatment, 6ß4 is enriched in the trail and the lagging edge of the cell, whereas the large lamelipodium is mostly devoid of the integrin. Left and right show the same cells, the brighter picture being included to demonstrate the formation of extended lamellae (arrow).

B5.5 had only a minor influence on migration of BSp73AS-ß4 cells (Fig. 3C and Table 1) and D6.1 hardly influenced migration of BSp73AS-D6.1A cells on Ln5-coated plates. Instead, migration of BSp73AS-db and Progressor cells was clearly improved in the presence of B5.5 or, more pronounced, D6.1. Notably, the effect was not seen during the first 24 hours (Tables 2 and 4). Increased migration was not due to an increase in proliferative activity, i.e. [³H]thymidine incorporation in BSp73AS-ß4, BSp73AS-D6.1A, BSp73AS-db, BSp73ASML and Progressor cells did not differ significantly when cells were cultured for 8 hours in the presence or absence of B5.5 or D6.1 (data not shown). PMA treatment, which also had no major impact on tumor cell proliferation (data not shown), strongly supported migration of BSp73AS-db and Progressor cells, while exerting a weaker, though significant effect on BSp73AS, BSp73AS-ß4 and BSp73AS-D6.1A cells. It should be mentioned that BSp73AS-db and Progressor readily spread all over the area initially protected by the cover slide (6 mm diameter), whereas BSp73AS, BSp73AS-ß4 and BSp73AS-D6.1A cells moved more slowly and stepwise (Table 3, Fig. 8B).

The PMA-induced increased motility of BSp73AS-db cells and metastasizing tumors was in line with the microscopically observed changes in cell shape and the redistribution of 6ß4 and D6.1A. The observation that co-expression of 6ß4 and D6.1A strongly supported migration on Ln5 supported our concept of the linked activity of the two molecules. Thus, it appeared worthwhile to ask whether co-expression of the two molecules might support metastasis formation.

Co-expression of 6ß4 and D6.1A supports liver metastasis formation
The 6ß4 integrin may be important for the early metastatic spread of pancreatic adenocarcinoma (Hermanek, 1998; Vogelmann et al., 1999) and metastastic spread of pancreatic tumors is most pronounced when cells settle in the peritoneal cavity (Z'graggen et al., 2001). One possible explanation could be that in the stimulatory surrounding of the peritoneal cavity the tetraspanin-induced redistribution of