|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 6 May 2003
doi: 10.1242/jcs.00450
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
and
of zebrafish: developmental expression and behavior during the cell cycle

1 Division of Electron Microscopy, Biocenter of the University of Wü
rzburg, Am Hubland, D-97074 Wü rzburg, Germany
2 Department of Biology, University of Ottawa, 30 Marie Curie, Ottawa, Ontario,
Canada K1N 6N5
3 Department of Biochemistry and Molecular Cell Biology, Vienna Biocenter,
University of Vienna, A-1030 Vienna, Austria
4 Department of Physiological Chemistry I, Biocenter of the University of
Wü rzburg, Am Hubland, D-97074 Wü rzburg, Germany
5 Ottawa Health Research Institute, 725 Parkdale Avenue, Ottawa, Ontario, Canada
K1Y 4E9
Author for correspondence (e-mail:
krohne{at}biozentrum.uni-wuerzburg.de)
Accepted 4 March 2003
| Summary |
|---|
|
|
|---|
and
have in common an N-terminal region with a LEM domain, and in the
C-terminal half of the molecule a lamina binding domain and a membrane
spanning sequence. The maternally synthesized
is the largest isoform
and the only LAP2 present in the rapidly dividing embryonic cells up to the
gastrula stage. ZLAP2
levels decrease during development, concomitant
with the increase of the somatic isoforms ZLAP2ß and
. In somatic
zebrafish cells ZLAP2
is the predominant isoform, whereas only small
amounts of ZLAP2ß are present.
During early embryonic development, ZLAP2
becomes associated with
mitotic chromosomes before anaphase. The surface of these chromosomes is
decorated with vesicles, and each chromosome assembles its own nuclear
envelope at the end of mitosis (karyomere formation). Ectopically expressed
ZLAP2
-green fluorescent protein (GFP) fusion protein targets vesicles
to mitotic chromosomes in Xenopus A6 cells, suggesting that
ZLAP2
is involved in karyomere formation during early zebrafish
development.
When ZLAP2ß and
were expressed as GFP fusion proteins in
Xenopus A6 cells, the ß- but not the
-isoform was found
in association with mitotic chromosomes, and ZLAP2ß-containing
chromosomes were decorated with vesicles. Further analysis of ZLAP2-GFP fusion
proteins containing only distinct domains of the ZLAP2 isoforms revealed that
the common N-terminal region in conjunction with ß- or
-specific
sequences mediate binding to mitotic chromosomes in vivo.
Key words: Zebrafish LAP2, Karyomere, Chromatin binding, Lamina, Mitosis
| Introduction |
|---|
|
|
|---|
Nuclear intermediate filament proteins, the lamins, are the major
structural elements of the lamina (for reviews, see
Gant and Wilson, 1997
;
Krohne, 1998
;
Gruenbaum et al., 2000
;
Wilson et al., 2001
). They are
essential architectural proteins implicated in the postmitotic reorganization
of the nucleus, including chromatin decondensation and replication
(Hutchison et al., 1994
;
Moir et al., 2000
;
Lopez-Soler et al., 2001
;
Holaska et al., 2002
; for a
review, see Benavente,
1991
).
The inner nuclear membrane is structurally and functionally distinct from
the other two membrane domains. It contains specific integral membrane
proteins (IMPs) that interact with the underlying lamina and the peripheral
chromatin during interphase (for reviews, see
Collas and Courvalin, 2000
;
Gruenbaum et al., 2000
;
Dechat et al., 2000a
;
Cohen et al., 2001
;
Goldman et al., 2002
).
So far, the best investigated IMPs of the inner nuclear membrane are
members of the lamina-associated polypeptide 2 (LAP2) family. In mammals, they
have been shown to be generated by alternative splicing from a single gene
(Harris et al., 1994
;
Berger et al., 1996
). Six
mammalian isoforms (LAP2
, ß,
,
,
and
)
have been identified, and Xenopus homologues to the rat LAP2ß
have been cloned (Gant et al.,
1999
; Lang et al.,
1999
). All isoforms except the mammalian LAP2
and
are type II IMPs with a short carboxyterminus projecting into the perinuclear
cistern and an N-terminal domain localized on the nucleoplasmic side of the
inner nuclear membrane (for a review, see
Dechat et al., 2000a
). All
mammalian isoforms possess the same N-terminal segment of 187 amino acids
(LAP2 constant region) that is highly conserved in Xenopus. Two
structural homologous globular domains of approximately 40-50 amino acids in
length (LAP2-N and LEM-motif) (Cai et al.,
2001
) have been located within this sequence. The LEM-motif is
also found in otherwise unrelated IMPs of the inner nuclear membrane, like
emerin and MAN1 (Lin et al.,
2000
). It interacts with the DNA binding protein BAF (barrier to
autointegration factor) (Furukawa,
1999
; Cai et al.,
2001
; Lee et al.,
2001
; Shumaker et al.,
2001
), suggesting that BAF is mediating the binding of LAP2 and
emerin to chromatin. Nuclear reconstitution experiments in Xenopus
egg extracts indicated that in vitro the LAP2 constant region and BAF are
directly or indirectly required for membrane-chromatin attachment and lamina
assembly (Gant et al., 1999
;
Shumaker et al., 2001
;
Segura-Totten et al., 2002
).
LAP2-N but not the LEM motif binds to DNA in vitro
(Cai et al., 2001
).
Other nuclear proteins binding to the mammalian LAP2ß are
germ-cell-less (Nili et al.,
2001
), HA95 (Martins et al.,
2000
) and B-type lamins
(Furukawa et al., 1995
;
Furukawa et al., 1998
). The
lamina/B-type lamin binding domain has been localized in rat LAP2ß
between amino acids 298 and 373 (Furukawa
et al., 1995
; Furukawa et al.,
1998
). Part of this sequence is highly conserved in
Xenopus LAP2 isoforms (Gant et
al., 1999
; Lang et al.,
1999
; Lang and Krohne, 2003).
LAP2
was found to be distributed throughout the nucleus and is not
enriched in the lamina (Dechat et al.,
1998
). It possesses a nuclear targeting/chromatin binding domain
(Vlcek et al., 1999
),
interacts with lamins A/C (Dechat et al.,
2000b
) and binds to mitotic chromosomes in in vitro nuclear
reconstitution experiments (Vleck et al., 2002).
LAP2
, ß and
are expressed in the majority of mammalian
cells, whereas in somatic cells of Xenopus only LAP2ß isoforms
have been detected (Lang et al.,
1999
). The absence of LAP2ß from Xenopus eggs and
embryos before gastrulation and the expression of a LAP2-related membrane
protein of higher molecular weight in oocytes and eggs indicate that this
class of IMPs is developmentally regulated in amphibia
(Lang et al., 1999
).
Here, we report on the molecular characterization of zebrafish LAP2 isoforms, on their expression pattern during embryonic development, and on their behavior during the cell cycle in the embryo and somatic cells.
| Materials and Methods |
|---|
|
|
|---|
Zebrafish ZF4 cells (Driever and
Rangini, 1993
) were cultured in Dulbecco's modified Eagle's
medium/F12 (D-MEM/F12; Gibco BRL, Burlington, ON, Canada) supplemented with
15% fetal calf serum (FCS; Gibco BRL) and 1% antibiotics (50 U/ml penicillin
and 50 µg/ml streptomycin; Sigma, St Louis, MO) at 27 oC/5%
CO2. AB9 is a cell line isolated from the caudal fin of zebrafish.
AB9 cells were maintained in D-MEM supplemented with 15% FCS, 2 mM L-glutamine
and 1% antibiotics under identical conditions.
Zebrafish embryos of defined stages were obtained as described by Kimmel et
al. (Kimmel et al., 1995
).
Zebrafish embryos and small tissue pieces of zebrafish liver, testicle and
ovary were directly homogenized and boiled in lysis buffer for analysis by
SDS-PAGE.
cDNA isolation and sequence analysis
A zebrafish kidney cDNA library spotted on filters (library no. 575 of the
Resource Center of the German Human Genome Project; Berlin) was screened by
standard methods. A double-stranded cDNA fragment comprising the complete
nucleotide sequence of the Xenopus LAP2
(Lang et al., 1999
) (Accession
No. Y17861) was [32P]-labeled using the random priming DNA labeling
kit ver. 1.1 (MBI Fermentas, St Leon-Roth, Germany) according to the
manufacturer's instructions. Hybridization was performed as recommended by the
supplier of the DNA filters. Both strands of the selected cDNA (zebrafish
LAP2-B4, Accession No. AJ320189) were sequenced as described
(Lang et al., 1999
).
For northern blot analysis, total RNA of zebrafish embryos at the
eight-cell stage, and at 3, 4.5, 7.5, 10, 24, and 48 hours postfertilization
(hpf) was isolated using the Trizol reagent (Gibco BRL) as described
(Gajewski and Krohne, 1999
).
Northern blot analysis was performed according to standard procedures as
described (Sambrook and Russell,
2000
), but using a modified Church buffer [1 mM EDTA, 0.5 M
phosphate buffer (pH 7.0), 7% (w/v) SDS].
Expression of LAP2 in bacteria and antibody production
A PCR product of the zebrafish LAP2-B4 cDNA coding for amino acids 1-165
was cloned into the pET-21a expression vector (Novagen, Bad Soden, Germany).
The targeted sequence was obtained using the following primers: 5'
AGCTTCATATGTTGGAATTTCTGGAAGAC 3' (5' end), and 5'
TCTTCCTCGAGGTCGCTGTACTGGTCTGAA 3' (3' end).
The sequence was expressed in Escherichia coli strain Bl 21 Codon
plus (Stratagene, Heidelberg, Germany) and proteins were affinity purified by
nickel-chelate affinity chromatography as recommended by the supplier (Qiagen,
Hilden, Germany). Two guinea pig antisera against zebrafish LAP2 (ZLAP2) were
generated as described previously (Cordes
et al., 1991
). ZLAP2-serum1 and ZLAP2-serum2 specifically react
with all zebrafish LAP2 isoforms and, in addition, ZLAP2-serum1 binds weakly
to LAP2 polypeptides from other vertebrates. Human autoimmune antibodies
against LAP2 (MAN serum) (Paulin-Levasseur
et al., 1996
; Lang et al.,
1999
) and mouse monoclonal lamin antibodies X155 and X223
(Lourim and Krohne, 1993
) have
been previously described. Mouse monoclonal antibodies against GFP were
obtained from Roche (Mannheim, Germany). To control for the specificity of
guinea pig antisera, polyclonal ZLAP2 antibodies were affinity purified using
bacterially expressed ZLAP2 (amino acids 1-165) coupled to CNBr-activated
SepharoseTM4B (Amersham Pharmacia, Freiburg/Germany).
RT-PCR, construction of expression vectors and immunoblotting
cDNA from zebrafish ovary and prim-5-stage embryos were prepared as
follows. Three ovaries and 50-100 embryos were homogenized in 5 ml of solution
D [4 M guanidinium thiocyanate, 25 mM sodium citrate pH 7, 0.5% sarcosyl
(N-laurosarkosimer), 7.2 µl of ß- mercaptoethanol per ml
solution D], and then mixed with 50 µl of 2 M sodium acetate (pH 4.0). Five
ml of water-saturated phenol and 2.5 ml chloroform/isoamylalcohol (24:1) were
added, mixed and incubated on ice for 20 minutes. After centrifugation at room
temperature for 10 minutes at 13,000 g, the upper phase was
re-extracted with 5 ml chloroform/isoamylalcohol and centrifuged. The RNA was
precipitated overnight with two volumes of ethanol, pelleted by centrifugation
(30 minutes, 4°C) and washed once with 80% ethanol.
The pellet was redissolved in 300 µl of `DNAse-Mix' (15 µl of New England Biolabs restriction buffer #2 or #3, 3 µl of RQ DNAse I, 1.5 µl of RNAsin, 1.5 µl of 100 mM DTT, 279 µl of water) and incubated at 37°C for 30 minutes. The solution was then mixed with 30 µl of 2 M sodium acetate (pH 4.0), extracted with phenol/chloroform (see above) and then precipitated overnight with two volumes of ethanol. The embryonic RNA was pelleted, and washed (see above). The pelleted oocyte RNA was dissolved in 500 µl of water, mixed with 500 µl of 8 M lithium chloride and precipitated for 6 hours at 20°C. After centrifugation and washing, the pellet was redissolved in 50 µl of water and the RNA was tested on an agarose gel.
The cDNA was prepared from 5 µg total RNA using the Supercript II reverse transcriptase from Gibco according to the manufacturer's instructions. It was then used as a template for PCR amplification. The following primer sequences containing a consensus Kozak site and an in-frame stop codon were selected from the LAP2-B4-cDNA and used for the amplification:
5' CTTGACATGTTGGAATTTCTGGAAGAC 3' (5' end), and 5'
TTATTTGCTGGTACTGTCATCTGTGCC 3' (3' end). The PCR products were
inserted into the pCR 2.1 TOPO vector (Invitrogen, Karlsruhe, Germany).
Inserts that had been controlled by sequencing were then excised with
KpnI and XhoI and cloned into the pBluescript KS vector.
Distinct sequences of the three zebrafish LAP2 cDNAs present in the
pBluescript KS vector were amplified by PCR and cloned into the eucaryotic
expression vectors pEGFP-C2 and pEGFP-N1 (Clontech, Heidelberg, Germany). The
PCR primers used are listed in Table
1. Coupled in vitro transcription/translation of cDNAs, SDS-PAGE
and immunoblotting were performed as described
(Lang et al., 1999
).
|
Microscopic procedures
Transfected Xenopus A6 cells grown on coverslips were fixed for 30
minutes with phosphate buffered saline (PBS: 137 mM NaCl, 3 mM KCl, 1.5 mM
KH2PO4, 7 mM Na2HPO4, pH 7.4)
containing 1.25% glutaraldehyde or 3% formaldehyde. For visualization of
chromatin, fixed cells were directly stained for 20 minutes with HOECHST 33258
(2.5 µg/ml PBS). Cells were not dried before mounting to preserve the
three-dimensional structure. Some coverslips were processed for
immunofluorescence after methanol/acetone fixation as described previously
(Lang et al., 1999
).
Zebrafish embryos at the 32-128 cell stage, at the late blastula stage (4 hpf) and the 13-somite stage (22 hpf) were manually dechorionated, fixed for 40-60 minutes in 3% formaldehyde/PBS, followed by an extraction with 1% Triton-X 100/PBS for 1 hour. The following steps were performed at 4°C. Tissue pieces and embryos were incubated with PBS containing 0.5-1% bovine serum albumin (PBS/BSA), followed by an overnight incubation with the primary antibody (ZLAP2-serum1, ZLAP2-serum2 diluted 1:300 in PBS/BSA or affinity purified antibodies from ZLAP2-serum1). Specimens were then washed three times each for 1 hour and incubated with secondary antibodies [anti-guinea pig immunoglobulin (Ig) G coupled to Texas Red diluted 1:200 in PBS/BSA] for 5 hours. For visualization of chromatin, preparations were stained with HOECHST 33258 (2.5 µg/ml) during the last 2 hours of the incubation with the secondary antibodies. Washed embryos (see above) were mounted with PBS containing 50% glycerol. The secondary antibodies used (anti-guinea pig IgG coupled to Texas Red; Dianova/Germany) did not stain any structure in zebrafish embryos when the primary antibody was omitted (data not shown). Digital images of transfected cells, living and fixed embryos were taken with a Confocal Laser Scanning Microscope (CLSM; TCS SP, Leica, Heidelberg, Germany) and with a Zeiss Axiophot (Zeiss, Jena, Germany) equipped with a CCD camera (software: CamWare V1.00).
For electron microscopic inspection, embryos were dechorionated, fixed at 4°C for 18 hours with 6.25% glutaraldeyde buffered with 0.1 M phosphate buffer (pH 7.4), washed for 30 minutes with 0.1 M phosphate buffer (pH 7.4), and then fixed for 2 hours with 2% OsO4 in 50 mM cacodylate (pH 7.2). Embryos were incubated overnight with 0.5% uranyl acetate (in H2O), dehydrated, embedded in Epon812 and ultrathin sectioned. To allow the electron microscopical analysis of Xenopus A6 cells expressing ZLAP2-GFP fusion proteins, cells were grown on CELLocate coverslips (Eppendorf, Hamburg, Germany), fixed 1-2 days after transfection with 1.25% glutaraldehyde in PBS and screened under the fluorescence microscope. Cells were subsequently fixed for 45 minutes with 2.5% glutaraldehyde in PBS and then processed as described for the embryos. Sections were analyzed with a Zeiss EM10 (Zeiss/LEO Oberkochen, Germany). Adobe Photoshop and PowerPoint were used for the preparation of figures.
Preparation of membranes from ovary, extractions of membranes and
transfected cells
All buffers were used at 4°C and the experiments were carried out at
4°C unless indicated otherwise. All buffers contained 0.1 µg/ml of
trypsin inhibitor and 0.2 mM phenylmethylsulfonyl fluoride. Sucrose-purified
total membranes from zebrafish ovaries were prepared as described
(Gajewski et al., 1996
).
Membrane aliquots were mixed with 1 ml of 4 M or 6 M buffered urea (1.5 mM
KH2PO4, 7 mM Na2HPO4), and
incubated for 10 minutes at 20°C. Samples were then fractionated by
centrifugation (120,000 g, 60 minutes) into pellet and
supernatant. The pellet was washed once with PBS and the proteins of the
supernatant were precipitated with chloroform/methanol
(Schmidt et al., 1994
).
Transfected cells grown in Petri dishes (35 mm diameters) were washed three times with PBS and harvested. Cells were then resuspended in 1 ml of 6 M or 8 M buffered urea (1.5 mM KH2PO4, 7 mM Na2HPO4) and incubated for 10 minutes. All further steps were carried out as described above.
| Results |
|---|
|
|
|---|
and 3' ends of the coding region of
clone B4 belong to the same gene, we carried out polymerase chain reactions
with two different cDNA preparations from Danio rerio. Using the same
set of primers, we could amplify DNA fragments of 1114, 1554 and 1980
nucleotides, which all contained an open reading frame with a start and stop
codon. Comparison of the predicted amino acid sequences revealed that we had
amplified three zebrafish LAP2 isoforms (ZLAP2) with lengths of 369
(ZLAP2
), 515 (ZLAP2ß) and 657 (ZLAP2
) amino acids
(Fig. 1A,B). All three proteins
possessed the same N-terminal domain (amino acids 1-214) with a LEM module,
and the same C-terminal sequence (155 amino acids) with a putative
transmembrane domain (TM) and a segment (lamin binding) exhibiting high
homologies to the lamina binding domain of Xenopus laevis and rat
LAP2ß (Lang and Krohne, 2003; Yang et
al., 1997
) and C-terminal [amino acids
229-264 in ZLAP2
; 72% identity with mouse LAP2
(see Lang and
Krohne, 2003)] ZLAP2 domains exhibited high sequence homologies with all other
known LAP2 except for the mammalian LAP2
. Comparison of ZLAP2ß and
ZLAP2
revealed that the ß isoform contained a characteristic
insertion of 146 amino acids (ß domain) with little homology to the
comparable regions of Xenopus and mammalian LAP2ß. The third
protein, ZLAP2
, was identical to ZLAP2ß except for two additional
insertions of 101 and 42 amino acids (
-domains) flanking the ß
domain. The
-domains exhibited no homology to all known LAP2 isoforms
including the mammalian LAP2
. The exchange of one amino acid in the
conserved C-terminal domain of ZLAP2
(V643A)
(Fig. 1B) is a fault of the
polymerase during the PCR.
|
We generated ZLAP2 antibodies (ZLAP2-serum1 and ZLAP2-serum2) specific for
epitopes in the common N-terminal domain to verify whether proteins with
predicted molecular weights of 40,447 Da (ZLAP2
), 56,278 Da
(ZLAP2ß) and 72,225 Da (ZLAP2
) are expressed in zebrafish. When
total proteins of testes, liver, ovary
(Fig. 2A) and two zebrafish
cell lines (Fig. 7C) were
analyzed by SDS-PAGE and immunoblotted using the ZLAP2-specific antibodies,
two polypetides with relative mobilities of 45,000 and 63,000 were detected. A
third immunoreactive polypeptide of 84,000 was present in embryos of the
blastula stage and ovary but was absent from somatic cells
(Fig. 2A) and from male germ
cells (data not shown). Polypeptides synthesized from the three cloned cDNAs
by coupled in vitro transcription/translation showed identical mobilities
(Fig. 2B), demonstrating that
the proteins detected by immunoblotting represent ZLAP2
(Mr 45,000), ß (Mr 63,000) and
(Mr 84,000). Antibodies from ZLAP2-serum1 and
ZLAP2-serum2 both reacted specifically with the three ZLAP2 isoforms, whereas
only antibodies from serum1 weakly recognized, in addition, the
Xenopus and mammalian LAP2 isoforms (data not shown).
|
|
To verify that the three identified zebrafish LAP2 isoforms possess
properties characteristic for integral membrane proteins, we extracted ovary
membrane fractions and cultured cells with urea. When cultured zebrafish cells
(AB9 cells and ZF4 cells) were extracted with 6 M and 8 M urea, ZLAP2ß
and
were largely recovered in the membrane pellet (approximately
80-90%, data not shown). Identical results were obtained when Xenopus
A6 cells expressing the C-terminal domain common to all three ZLAP2 isoforms
as a GFP fusion protein (e.g. amino acids 503-657 of ZLAP2
; GFP503-657)
have been extracted with urea (Fig.
3A). GFP503-657 was retained in the membrane pellet, whereas
peripheral membrane proteins like lamins were recovered in the supernatant
(Fig. 3A'). In transfected
Xenopus A6 cells, GFP503-657 was localized at the nuclear envelope,
and variable amounts were detectable in the endoplasmic reticulum (Lang and
Krohne, 2003). Extractions of whole cellular membranes of zebrafish ovaries
with 4 M urea confirmed that ZLAP2
and
possesses properties
characteristic for integral membrane proteins
(Fig. 3B,B'). During the
extraction with higher urea concentrations (6 M,
Fig. 3B, lanes 3 and 4),
apparently a significant amount of very small membrane fragments had been
formed that could not be pelleted. A similar behavior of integral membrane
proteins of Xenopus ovary extracts in the presence of urea has been
observed previously (Gajewski and Krohne,
1999
; Lang et al.,
1999
). Also, we noted that the nucleoplasmic domain of ZLAP
is more susceptible to degradation than that of the ß and
isoforms. Therefore, we always detected immunoreactive bands with lower
molecular weights on immunblots of the supernatants. Our urea extractions show
that the three ZLAP2 isoforms are integral membrane proteins.
|
The analysis of ZLAP2 expression during development revealed that the
isoforms are developmentally regulated both at the mRNA
(Fig. 4A,B) and at the protein
levels (Fig. 4C), comparable to
the situation in amphibia (Lang et al.,
1999
). In embryos at the eight-cell stage and in embryos during
the blastula stage (Fig. 4A,
lanes 1-3), we detected only an mRNA band of 2.8 kb that reacted with an
-specific probe. Lower amounts of the
-mRNA were also detectable
in embryos at the late gastrula stage (7.5 hpf) but not in the older
developmental stages tested (Fig.
4A, lanes 5-7). When the complete ZLAP2
was used for
hybridization (Fig. 4B), the
- mRNA was detected as well as additional mRNAs in embryos at the late
gastrula (7.5 hpf) and in older developmental stages. These mRNA bands had
sizes of 3.6, 2.6, 1.9 and 1.6 kb. We suggest that these mRNAs in older
embryos (Fig. 4B, lane 4) are
coding for ZLAP2ß and g. It is not unusual that LAP2 mRNAs possess long
non-translated 3' ends. For the mammalian LAP2ß mRNAs, sizes of 3.5
and 2 kb have been reported (Furukawa et
al., 1995
). We cannot rule out that some of the mRNAs detected
(Fig. 4B, lanes 4-7) are coding
for additional LAP2 isoforms with mobilities on SDS-PAGE close to that of
ZLAP2ß,
or
.
|
Immunoblots supported the interpretation of our northern blot data. At the
protein level, LAP2
was the only isoform present in embryos up to the
early gastrula stage (Fig. 4C).
By contrast, LAP2ß and
were absent from early developmental
stages and first detectable at the late gastrula stage
(Fig. 4C, lane 4).
Interestingly, the expression of LAP2ß/
and somatic B-type lamins
started at the same time point during development
(Fig. 4D, lane 4) [for the
characterization of the B-type lamin specific for the female germ line of the
zebrafish see Yamaguchi et al.; see also Hofemeister et al.
(Yamaguchi et al., 2001
;
Hofemeister et al., 2002
)].
The amount of LAP2
per embryo decreased with the progression of
development concomitant with the increase of somatic LAP2 isoforms. In embryos
aged 36 hours, LAP2
was barely detectable. In all embryonic stages
tested, the ß and
isoforms were expressed at the same level,
whereas LAP2
was the predominant polypeptide in somatic tissues of
adult organism (see Fig. 2A),
as well as in two zebrafish cell lines tested
(Fig. 7C). Owing to the lack of
ZLAP2
-specific antibodies, we cannot exclude that this isoform is
expressed in the adult organism in specialized cells of some organs as it has
been shown for a Xenopus B type lamin (lamin LIII/B3)
(Benavente et al., 1985
).
The behavior of ZLAP2 isoforms during the cell cycle in the embryo
and somatic cells
To learn more about the properties of the
-isoform in comparison
with LAP2ß and
, we analyzed cleavage stages of embryos and
cultured cells. The immunolabeling of embryos at developmental stages
expressing exclusively LAP2
with our LAP2-specific antibodies indicated
that the
isoform is localized at the nuclear envelope during
interphase, as depicted in Fig.
5D. The inspection of mitotic cells from embryos aged 1-2 hours
and 4 hours revealed the staining of anaphase chromosomes
(Fig. 5B,F). The staining of
metaphase chromosomes was clearly visible in the early cleavage stages
(Fig. 5A; 1-2 hpf) but not in
older embryos (Fig. 5E; 4 hpf).
The electron microscopic inspection of blastomeres from the same developmental
stages showed that variable numbers of vesicles, which often appeared
flattened, were associated with mitotic chromosomes. On metaphase chromosomes,
fewer vesicles were seen (data not shown) than on chromosomes at anaphase
(Fig. 6A). In addition,
numerous vesicles were regularly seen in the cytoplasm bordering the
chromosomes (Fig. 6A). The
morphology of reforming nuclei at telophase during the blastula stage
(Fig. 5C) indicated that a
nuclear envelope had been assembled around single or few chromosomes
(Fig. 5C; karyomere formation)
before the formation of a common nuclear envelope enclosing all chromosomes in
later interphase (Fig. 5D).
Further electron microscopic analysis revealed that during telophase each
chromosome assembles its own nuclear envelope
(Fig. 6B). In older embryos
(11-13 hpf = 5-8 somite stage; see Fig.
4A) that contained beside LAP2
considerable amounts of the
somatic isoforms, only minute amounts of membranes were found in contact with
anaphase chromosomes, and no karyomere formation could be seen in telophase.
In the embryos aged 12 hours, only very faint, if any, staining of anaphase
chromosome was detectable with ZLAP2-specific antibodies.
|
|
When we analyzed cultured zebrafish ZF4 and AB9 cells that expressed
exclusively the ZLAP2ß and
(Fig. 7C), we noted that
was the predominant isoform, whereas only minor amounts of the
ß-isoform were detectable. In these cultured cells, we observed no
labeling of metaphase chromosomes during mitosis
(Fig. 7A,A') and, in anaphase
cells, only areas on the chromosome surface were stained where the reassembly
of the nuclear envelope has begun (Fig.
7B,B'). Our data indicate that, during early embryogenesis, a
significant amount of ZLAP2
associates with chromosomes much earlier
during the progression of mitosis than LAP2 isoforms in somatic zebrafish
cells.
Distinct behavior of GFP-ZLAP2 fusion proteins during mitosis in
transfected A6 cells
Our immunofluorescence data suggest that ZLAP2
possesses properties
distinct from those of the ß and
isoforms. To verify our
observations by a methodology independent of antibodies, we generated
eukaryotic expression vectors allowing the in vivo analysis of the three
isoforms as GFP fusion proteins in transfected Xenopus A6 cells. We
selected Xenopus A6 cells for transfection because they are cultured
at a temperature that is optimal for the growth of zebrafish embryos and
adults. A further reason is that the folding and assembly of at least some
zebrafish and Xenopus proteins is not optimal at temperatures above
their body temperature (Cerda et al.,
1998
).
The analysis of total proteins from transfected cells by SDS-PAGE and
immunoblotting with GFP antibodies revealed that each of the three GFP-LAP2
fusion proteins possessed the expected apparent molecular weight (data not
shown). During interphase in A6 cells, all three GFP-ZLAP2 fusion proteins
were localized in the nuclear envelope
(Fig. 8A) and variable amounts
in the endoplasmic reticulum. In mitotic cells, ZLAP2
-GFP
(Fig. 8B) and ZLAP2ß-GFP
(Fig. 8C) were found in
association with chromosomes. By contrast, ZLAP2
- GFP exhibited a
diffuse and, in addition, dot-like staining in mitotic cells but did not
colocalize with chromosomes (Fig.
8D). The comparative analysis of the three ZLAP2-GFP fusion
proteins suggest that the domains common to all three isoforms do not mediate
binding to mitotic chromosomes. To verify our hypothesis we generated a number
of deletion mutants (see Table
2). A GFP-ZLAP2 fusion protein containing exclusively the
N-terminal domain (amino acids 1-214 of ZLAP2; 1-214GFP) common to all three
isoforms was homogeneously distributed in the cytoplasm of A6 cells during
mitosis and also detectable in regions containing the mitotic chromosomes
(Fig. 9A). Two fusion proteins
containing the common aminoterminus in conjunction with ß-specific
sequences (Fig. 9B; amino acids
1-360 of ZLAP2ß; 1-360GFP) or ß-sequences together with the
-
sequences (amino acids 1-502 of ZLAP2
; 1-502GFP; data not shown) were
predominantly localized on chromosomes in mitotic cells. By contrast, GFP
fusion proteins containing exclusively ß- and/or
- specific
sequences were excluded from cellular regions containing chromosomes during
mitosis in transfected Xenopus A6 cells
(Fig. 9C; shown for mutant
214-502GFP) (see Table 2). Our
results indicate that not a single domain but the common N-terminal domain in
conjunction with ß- and/or
- specific sequences mediates binding
of the ß- and
- isoforms to mitotic chromosomes.
|
|
|
Ectopically expressed ZLAP2ß and ZLAP2
target vesicles to
mitotic chromosomes
We have shown that the nucleoplasmic domain of ectopically expressed
ZLAP2ß and
bind to chromatin and that ZLAP2
isolated from
zebrafish ovaries possesses properties characteristic for integral membrane
proteins (see Fig. 3B). To
verify whether these two isoforms in contrast to
ZLAP2
could be involved in the early targeting of vesicles to
mitotic chromosomes, we expressed the three full-length polypeptides as
GFP-fusion proteins in Xenopus A6 cells. When cells comparable to
those shown in Fig. 8B-D were
processed for electron microscopy, we noted that mitotic chromosomes of cells
expressing ZLAP2
(Fig.
10A,B,D) or ZLAP2ß (data not shown) were associated with
numerous vesicles, giving the chromosomes a `sponge-like' morphology. Vesicles
of comparable morphology could not be detected on mitotic chromosomes of cells
expressing ZLAP2
(Fig.
10C,E). The membrane stacks
(Fig. 10C,E) visible in the
vicinity of the mitotic chromosomes corresponded to the dot-like structures
seen by fluorescence microscopy in mitotic
(Fig. 8D) and interphase cells
(Fig. 8A).
|
| Discussion |
|---|
|
|
|---|
a novel polypeptide that
is expressed in oocytes and during early embryonic development. ZLAP2
possesses properties distinct from that of ZLAP2
, the major isoform in
zebrafish somatic cells.
What are the putative functions of ZLAP2
during early
embryonic development?
ZLAP2
is a type II membrane protein and the only LAP2 isoform
expressed during a developmental stage that is characterized by very rapid
cell divisions (cell-cycle length 15-20 minutes)
(Kimmel et al., 1995
). Further
important features of this stage include the association of vesicles with
mitotic chromosomes, and the nuclear envelope assembly around individual
chromosomes (karyomere formation) at the end of mitosis. By the expression of
GFP-LAP2
fusion proteins in cultured cells, we have provided clear
evidence that the
isoform binds to chromatin and associates with
mitotic chromosomes. The mitotic chromosomes of transfected cells ectopically
expressing full-length LAP2
- GFP have similarities with the mitotic
chromosomes of rapidly dividing zebrafish early blastomeres. First, many
vesicles are associated with the chromosomes, and second, the chromatin of
these chromosomes is less condensed than that of chromosomes free of
membranes. Our data therefore indicate that ZLAP2
is involved in the
very early binding of nuclear envelope forming vesicles to the surface of
individual chromosomes during early embryonic development, thus facilitating
the reformation of the nuclear envelope around each chromosome at the end of
the very short embryonic cell cycles (see
Fig. 5A-C). A protein with
comparable properties has so far not been described in mammals.
Karyomere formation is also characteristic of the very short cell cycles
before the midblastula transition in Xenopus
(Montag et al., 1988
;
Lemaitre et al., 1998
) (see
also therein for karyomere formation in other organisms). Xenopus
embryos contain a maternally expressed LAP2-related integral membrane protein
that has several properties in common with ZLAP2
(Lang et al., 1999
). The
characterization of a Xenopus LAP2 cDNA clone (Accession No.
AJ514937) that had been isolated in the course of the characterization of
Xenopus LAP2ß (Lang et al.,
1999
) revealed that the in vitro translated polypeptide encoded by
this cDNA is comigrating with the Xenopus LAP2 protein of Mr 84,000
expressed in oocytes and during early embryonic development (Lang et al.,
unpublished). This protein exhibited a sequence identity of 97% with a
previously published Xenopus LAP2 isoform
(Gant et al., 1999
) (Accession
No. AF048815). The Xenopus LAP2
is 99 amino acids shorter than
the zebrafish isoform but much more acidic (XLAP2
: pI 6.16;
ZLAP2
: pI 9.17). This is most probably the reason for its unusual slow
mobility on SDS-PAGE (Lang et al., unpublished). The low sequence identities
of the Xenopus and zebrafish LAP2
in the central part of both
molecules suggests that these isoforms are adaptations to the different cell
cycle length of Xenopus and zebrafish blastomeres before the
midblastula transition.
Binding of ZLAP2ß to mitotic chromosomes
In the cultured zebrafish cells tested, ZLAP2ß was present only in
minor amounts and could not be distinguished from the abundant
-isoform
due to the lack of isoform-specific antibodies. Therefore the staining of
mitotic cells with LAP2 antibodies (see
Fig. 7) is most likely to
reflect the distribution ZLAP2
and is in agreement with the behavior of
ZLAP2
- GFP in transfected cells. It is questionable whether
chromosome-bound endogenous ZLAP2ß could be detected in cultured
zebrafish cells with the presently available tools.
The comparison of the behavior of our ZLAP2 fusion proteins during mitosis
indicates that the GFP moiety of the fusion protein does not mediate
chromosome binding, and that the common carboxyterminus of the three isoforms
is not involved in this process. The intracellular distribution of the ZLAP2
deletion mutants tested (see Fig.
9 and Table 2)
suggests that the common N-terminal domain alone does possess a weak affinity
for mitotic chromatin in transfected Xenopus A6 cells. This affinity
is enhanced when ß- and/or
- specific sequences are present in the
proteins. An observation of Vlcek and coworkers
(Vlcek et al., 1999
) could
help to explain why the common aminoterminus in conjunction with ß-
and/or
- specific sequences enhances the binding of ZLAP2 to mitotic
chromosomes. Vlcek found that a GST fusion protein containing the common
N-terminal domain (amino acids 1-187) of the mammalian LAP2 binds in vitro to
mitotic chromosomes (Vlcek et al.,
1999
). It is known that GST forms dimers and oligomers. It is
worth speculating that ß- and
- specific sequences do modulate
oligomerization of ZLAP2 thus facilitating the binding of the common
aminoterminus to chromatin.
Ectopically expressed LAP2 fusion proteins are often present in the
transfected cells in a higher concentration than the endogenous LAP2 isoforms.
If the oligomerization of ZLAP2ß was a prerequisite for its binding to
mitotic chromosomes, binding to mitotic chromosomes in cells expressing
ZLAP2ß- GFP fusion proteins would be expected to occur much earlier
during the cell cycle than in non-transfected cells because the ectopically
expressed protein is present in higher cellular concentrations than the
endogenous LAP2. This notion is supported by the observation that ectopically
expressed ZLAP2ß and
are found in association with metaphase
chromosomes (see Fig. 8B,C).
Other than for ZLAP2ß, the behavior of ZLAP2
- GFP in transfected
cells is in agreement with the distribution of endogenous ZLAP2
in
early embryonic cells during mitosis. In the cleavage period the
-
isoform is associated with chromosomes throughout all mitotic stages
(Fig. 5). We conclude from our
data that the observed differences in the mitotic behavior of ZLAP2
compared with the ß- and
- isoforms reflect intrinsic properties
of the polypeptides.
How many LAP2 isoforms are expressed in zebrafish?
We have identified by cDNA cloning three different splice products of the
ZLAP2 gene: one ß, one
and one
isoform. To our surprise,
several mRNAs of embryos aged 48 hours hybridized to the LAP2-specific probe.
Therefore, we cannot rule out that some of the mRNAs detected are coding for
additional minor LAP2 isoforms with mobilities on SDS-PAGE close to that of
ZLAP2ß,
or
.
For the following reasons it is unlikely that D. rerio is
expressing a homologue to the mammalian LAP2
. Antibodies specific for
the common N-terminal domain of all so far identified vertebrate LAP2 isoforms
(MAN antibodies) (Paulin-Levasseur et al.,
1996
; Lang et al.,
1999
) (ZLAP2-serum1 and ZLAP2-serum2) (this manuscript) did not
detect a polypeptide with the size of mammalian LAP2
in protein samples
of somatic tissues and cultured cells but only two significant smaller
polypeptides that represent zebrafish LAP2ß and
. The only
immunoreactive polypeptide of similar size to the mammalian LAP2
is
expressed in zebrafish oocytes and during early embryonic development. We have
shown that this protein represents ZLAP2
. In this respect it is
interesting that a homologue to the mammalian LAP2
is apparently also
absent from somatic cells of Xenopus
(Lang et al., 1999
), and other
amphibia and fishes (del Pino et al.,
2002
). Our present study will now enable us to analyze zebrafish
LAP2 functions at the genetic level in this model vertebrate.
| Acknowledgments |
|---|
is
AJ514937. | Footnotes |
|---|
| References |
|---|
|
|
|---|
Benavente, R. (1991). Postmitotic nuclear reorganization events analyzed in living cells. Chromosoma 100,215 -220.[CrossRef][Medline]
Benavente, R., Krohne, G. and Franke, W. W. (1985). Cell type-specific expression of nuclear lamina proteins during development of Xenopus laevis. Cell 41,177 -190.
Berger, R., Theodor, L., Shoham, J., Gokkel, E., Brok-Simoni,
F., Avraham, K. B., Copeland, N. G., Jenkins, N. A., Rechavi, G. and Simon, A.
J. (1996). The characterization and localization of the mouse
thymopoietin/lamina-associated polypeptide 2 gene and its alternatively
spliced products. Genome Research
6, 361-370.
Cai, M., Huang, Y., Ghirlando, R., Wilson, K. L., Craigie, R. and Clore, G. M. (2001). Solution structure of the constant region of nuclear envelope protein LAP2 reveals two LEM-domain structures: one binds BAF and the other binds DNA. EMBO J. 20,4399 -4407.[CrossRef][Medline]
Cerda, J., Conrad, M., Markl, J., Brand, M. and Herrmann, H. (1998). Zebrafish vimentin: molecular characterization, assembly properties and developmental expression. Eur. J. Cell Biol. 77,175 -187.[Medline]
Cohen, M., Lee, K. K., Wilson, K. L. and Gruenbaum, Y. (2001). Transcriptional repression, apoptosis, human disease and the functional evolution of the nuclear lamina. Trends Biochem. Sci. 26,41 -47.[CrossRef][Medline]
Collas, P. and Courvalin, J.-C. (2000). Sorting nuclear membrane proteins at mitosis. Trends Cell Biol. 10,5 -8.[CrossRef][Medline]
Cordes, V., Waizenegger, I. and Krohne, G. (1991). Nuclear pore complex glycoprotein p62 of Xenopus laevis and mouse. cDNA cloning and identification of its glycosylated regions. Eur. J. Cell Biol. 55, 31-47.[Medline]
Dechat, T., Gotzmann, J., Stockinger, A., Harris, C. A., Talle,
M. A., Siekierka, J. J. and Foisner, R. (1998).
Detergent-salt resistance of LAP2
in interphase nuclei and
phosphorylation-dependent association with chromosomes early in nuclear
assembly implies functions in nuclear structure dynamics. EMBO
J. 17,4887
-4902.[CrossRef][Medline]
Dechat, T., Vleck, S. and Foisner, R. (2000a). Lamina-associated polypeptide 2 isoforms and related proteins in cell cycle-dependent nuclear structure dynamics. J. Struct. Biol. 129,335 -345.[CrossRef][Medline]
Dechat, T., Korbei, B., Vaughan, O. A., Vlcek, S., Hutchison, C.
J. and Foisner, R. (2000b). Lamina-associated polypetide
2
binds intranuclear A-type lamins. J. Cell
Sci. 113,3473
-3484.[Abstract]
del Pino, E. M., Sáenz, F. E., Pérez, O. D., Brown, F. D., Ávila, M.-E., Barragán, V. A., Haddad, N., Paulin-Levasseur, M. and Krohne, G. (2002). The LAP2 (lamina-associated polypeptide 2) expression in fish and amphibians. Int. J. Dev. Biol. 46,227 -234.[Medline]
Driever, W. and Rangini, Z. (1993). Characterization of a cell line derived from Zebrafish embryos. In vitro Cell. Dev. Biol. 29A,749 -754.
Furukawa, K. (1999). LAP2 binding protein 1 (LAP2P1/BAF) is a candidate mediator of LAP2-chromatin interaction. J. Cell Sci. 112,2485 -2492.[Abstract]
Furukawa, K., Panté, N., Aebi, U. and Gerace, L. (1995). Cloning and cDNA for lamina-associated polypeptide 2 (LAP2) and identification of regions that specify targeting to nuclear envelope. EMBO J. 14,1626 -1636.[Medline]
Furukawa, K., Fritze, C. E. and Gerace, L.
(1998). The major nuclear envelope targeting domain of LAP2
coincides with its lamin binding region but is distinct from its chromatin
interaction domain. J. Biol. Chem.
273,4213
-4219.
Gajewski, A. and Krohne, G. (1999). Subcellular distribution of the Xenopus p58/lamin B receptor in oocytes and eggs. J. Cell Sci. 112,2583 -2596.[Abstract]
Gajewski, A., Lourim, D. and Krohne, G. (1996). An antibody against a glycosylated integral membrane protein of the Xenopus nuclear pore complex: A tool for the study of pore complex membranes. Eur. J. Cell Biol. 71,14 -21.[Medline]
Gant, T. M. and Wilson, K. L. (1997). Nuclear assembly. Annu. Rev. Cell Dev. Biol. 13,669 -695.[CrossRef][Medline]
Gant, T. M., Harris, C. A. and Wilson, K. L.
(1999). Roles of LAP2 proteins in nuclear assembly and DNA
replication: truncated LAP2ß proteins alter lamina assembly, envelope
formation, nuclear size, and DNA replication efficiency in Xenopus
laevis extracts. J. Cell Biol.
144,1083
-1096.
Goldman, R. D., Gruenbaum, Y., Moir, R. D., Shumaker, D. K. and
Spann, T. P. (2002). Nuclear lamins: building blocks of
nuclear architecture. Genes Dev.
16,533
547.
Gruenbaum, Y., Wilson, K. L., Harel, A., Goldberg, M. and Cohen, M. (2000). Nuclear lamins structural proteins with fundamental functions. J. Struct. Biol. 129,313 -323.[CrossRef][Medline]
Harris, C. A., Andryuk, P. J., Cline, S. C., Natarajan, A.,
Siekierka, J. J. and Goldstein, G. (1994). Three distinct
human thymopoietins are derived from alternatively spliced mRNAs.
Proc. Natl. Acad. Sci. USA
91,6283
-6287.
Hofemeister, H., Kuhn, C., Franke, W. W., Weber, K. and Stick, R. (2002). Conservation of the gene structure and membrane targeting signals of germ cell specific lamin LIII in amphibians and fish. Eur. J. Cell Biol. 81,51 -60.[CrossRef][Medline]
Holaska, J. M., Wilson, K. L. and Mansharamani, M. (2002). The nuclear envelope, lamins and nuclear assembly. Curr. Opin. Cell Biol. 14,357 -364.[CrossRef][Medline]
Hutchison, C. J., Bridger, J. M., Cox, L. S. and Kill, I. R. (1994). Weaving a pattern from disparate threads: lamin function in nuclear assembly and DNA replication. J. Cell Sci. 107,3259 -3269.[Abstract]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Krohne, G. (1998). Lamin assembly in vivo. In Subcellular Biochemistry: Intermediate filaments (ed. H. Herrmann and J. Robin Harris), pp. 563-586. London: Plenum Publishing.
Lang, C. and Krohne, G. Lamina-associated polypeptide 2ß (LAP2ß) is contained in a protein complex together with A- and B-type lamins. Eur. J. Cell Biol. 82,143 -153.
Lang, C., Paulin-Levasseur, M., Gajewski, A., Alsheimer, M., Benavente, R. and Krohne, G. (1999). Molecular characterization and developmentally regulated expression of Xenopus lamina-associated polypeptide 2 (XLAP2). J. Cell Sci. 112,749 -759.[Abstract]
Lee, K. K., Haraguchi, T., Lee, R. S., Koujin, T., Hiraoka, Y. and Wilson, K. L. (2001). Distinct functional domains in emerin bind lamin A and DNA-bridging protein BAF. J. Cell Sci. 114,4567 -4573.[Medline]
Lemaitre, J. M., Geraud, G. and Mechali, M.
(1998). Dynamics of the genome during early Xenopus
laevis development: Karyomeres as independent units of replication.
J. Cell Biol. 142,1159
-1166.