|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
Cancer Research UK London Research Institute, Cell Cycle Laboratory, 44 Lincoln's Inn Fields, London, WC2A 3PX, UK
* Author for correspondence (e-mail: t.niccoli{at}cancer.org.uk )
Accepted 29 January 2002
| Summary |
|---|
|
|
|---|
Key words: Fission yeast, Shmooing, Morphogenesis, Tea1, Tea2, Tip1, Pom1
| Introduction |
|---|
|
|
|---|
Some of the major players involved in the selection and maintenance of
sites for polarised growth, such as Cdc42p
(Miller and Johnson, 1994
;
Johnson, 1999
), Rho proteins
(Arellano et al., 1999
), PAKS
(Ottilie et al., 1995
) and
G-protein-coupled receptors (Kitamura and
Shimoda, 1991
), are conserved from yeast to mammals, suggesting
that the basic mechanisms involved may have been conserved throughout
evolution. Studies in higher eukaryotes have shown that some signals inducing
differentiation also alter microtubular dynamics, suggesting that this might
be an essential step in the regulation of cell shape during the process of
differentiation (Chausovsky et al.,
2000
; Spencer et al.,
2000
), although it is not known how the switch in microtubular
dynamics takes place and how this leads to an alteration in cell shape.
The genetically amenable fission yeast (Schizosaccharomyces pombe)
is a useful model system to study this problem. It displays both modes of
polarised cell growth: one intrinsically established during vegetative growth
and one extrinsically determined during mating. The intrinsic growth mode
directs polarisation to produce cylindrical rods extending mostly in a bipolar
fashion from the ends of the cell. When such a cell undergoes medial fission
it generates two daughter cells, each with a new end at the site of cell
division and an old end inherited from the mother cell
(Mitchison and Nurse, 1985
).
After cytokinesis cells begin to grow monopolarly from the old end and at a
specified point during the cell cycle they undergo NETO (new end take off),
when growth at the new end is activated to generate a bipolarly growing cell.
Actin is located at actively growing ends during interphase and is relocated
to form a medial ring at the site of cell division at cytokinesis
(Marks et al., 1986
).
Cytoplasmic microtubules nucleate from sites adjacent to the nuclear membrane
and span the length of the cell terminating at the cell ends
(Drummond and Cross, 2000
;
Hagan, 1998
;
Hagan and Hyams, 1988
). This
mode of growth allows cells to extend in a straight line
(Brunner and Nurse, 2000b
).
Fission yeast cells have two mating types, h+ and h-,
and can conjugate only with a cell of an opposite mating type
(Egel, 1971
;
Egel, 1989
;
Gutz and Doe, 1975
). During
mating, fission yeast cells activate a new pattern of cell growth that allows
them to bend towards a mating partner. This extrinsic growth mode is induced
by a pheromone secreted from cells of opposite mating type and is, therefore,
extrinsically determined (Fukui et al.,
1986
; Leupold,
1987
). Cells are capable of detecting the directionality of the
pheromone gradient, and orient their mating projection towards the pheromone
source (Fukui et al., 1986
;
Leupold, 1987
). Cells then
touch and undergo cellular and nuclear fusion, which is followed by meiosis
and the formation of four haploid spores
(Nielsen and Davey, 1995
).
Shmooing cells are characteristically bent, with one pointed and one rounded
end, and extend in a monopolar fashion from the pointed end, where actin is
localised (Petersen et al.,
1998b
). Microtubules curve round the non-growing end and terminate
at the shmooing end (Petersen et al.,
1998a
). Thus the vegetative and the shmooing growth modes are
characterised by different cell shapes and these may be the result of
differences in the regulation of microtubular dynamics and the cell
polarisation machinery.
Various morphological factors may have roles in regulating the intrinsic
and extrinsic growth modes. Tea1p is a cell end marker involved in regulating
microtubular dynamics and the selection of growth sites during vegetative
polarised growth. Tea1
cells have some long microtubules that
bend round the cell ends (Mata and Nurse,
1997
) and are often bent with occasional branching. Cells that
have been starved and then returned to growth exhibit a dramatic increase in
the number of branches formed (M. Arellano, unpublished). This suggests that
the internal memory, marking growth sites at the ends of the cell, is lost
during starvation. Tea1p is normally located at the cell ends and at
microtubular tips and may trigger microtubule depolymerisation once the
microtubules have reached the cell ends, thus maintaining growth along a
single axis (Mata and Nurse,
1997
). In the presence of pheromone, Tea1p was found to delocalise
from the cell ends, consistent with it being part of a vegetative specific
machinery that is shut down in shmooing cells
(Mata and Nurse, 1997
),
allowing them to grow away from the long axis of the cell.
Two further factors, Tea2p and Tip1p, which act upstream in the Tea1
pathway also play a role in microtubular dynamics and cell polarity
(Browning et al., 2000
;
Brunner and Nurse, 2000a
). In
the absence of either of these factors, microtubules are short and rarely
reach the cell ends. Tip1p, a CLIP 170-like protein, has been shown to
stabilise microtubules when they reach the cell periphery, allowing them to
grow just beneath the cell cortex until they have reached the cell ends. This
enables microtubules to align along the long axis of the cell
(Brunner and Nurse, 2000a
).
Tip1p forms a complex with Tea2p (D. Brunner and P.N., unpublished), a
kinesin-like protein, and both are found at the tips of microtubules and at
the ends of cells (Browning et al.,
2000
; Brunner and Nurse,
2000a
). Like Tea1p, these factors play a role in growth site
selection. Tip1
and tea2
cells are bent and
branch at a low frequency during exponential growth. On re-growth from
starvation, like tea1
cells, the number of branched cells
increases dramatically (Browning et al.,
2000
; Brunner and Nurse,
2000a
). The short microtubules of tip1
and
tea2
cells could be partly or wholly responsible for the
defects in cell polarity, given that short microtubules are known to lead to
cell branching (Sawin and Nurse,
1998
). It is possible that Tea1p, Tea2p and Tip1p are part of the
machinery regulating microtubular dynamics, which ensures that cells grow from
opposite poles and extend along the long axis of the cell
(Browning et al., 2000
;
Brunner and Nurse, 2000a
;
Mata and Nurse, 1997
;
Sawin and Nurse, 1998
).
Markers of cell ends also play an essential role in maintaining cell shape.
Pom1p, a protein kinase found at cell ends, is involved in NETO, septation and
marking cell ends (Bahler and Pringle,
1998
). In the absence of Pom1p, cells are bent or T-shaped,
monopolar, and have misplaced septa (Bahler
and Pringle, 1998
) and slightly longer microtubules
(Bahler and Nurse, 2001
).
Here we investigate the role of Tea1p, Tea2p and Tip1p in response to an external pheromone signal, with the intention of studying what parts of the vegetative growth mode machinery need to be dismantled to allow the switch to a new extrinsic mode of growth. We show that these factors no longer play a role in regulating microtubular dynamics in the presence of pheromone. In contrast, Pom1p, a factor involved in the identification of cell ends during vegetative growth, may play a role in the switch to the extrinsic growth mode.
| Materials and Methods |
|---|
|
|
|---|
|
Construction of Tip1YFP strain
The tip1 gene was PCR amplified using the primers:
CGCGTCGACCTAAATGTTTCCTCTTGGG (3') and CGGGATCCCCAGCTTCGTCTGTGCTGCC
(5'), and the resulting product was cloned as a
SalI/BamHI-digested fragment into pREP5X-YFP (Decottignie et
al., 2001) to create a tip1 gene tagged at the C-terminus with
YFP.
The pREP5 tip1YFP plasmid was integrated into a wild-type ade
6-704 strain placing the endogenous tip1 gene under the control
of the nmt promoter and tip1 YFP under the control of the
endogenous promoter. The nmt tip1 sup3-5 genomic fragment was then
replaced with a KanR cassette by a further integration of the
pFA-kanMX6 (Bähler et al.,
1998
). The resulting strain was kanamycin resistant, adenine
deficient and had tip1YFP driven by the tip1 promoter. This
strain was then crossed into the cyr1
sxa2
background. Tip1YFP (A. Decottignie, personal communication) is almost
completely functional; microtubules look normal and the shmooing rate is
similar to wild-type but there is a slight NETO defect.
Immunofluorescence microscopy
To detect tubulin and Tea1p, cells were fixed in -70°C methanol and
processed as previously described (Mata
and Nurse, 1997
). Tubulin was visualised using TAT1 monoclonal
antibody [a gift from K. Gull, University of Manchester, UK
(Woods et al., 1989
)] at 1:50,
Tea1p with anti-Tea1 at 1:1000 (Mata and
Nurse, 1997
) and Tip1p with anti-Tip1 at 1:200
(Brunner and Nurse, 2000a
). The
secondary antibodies were goat anti-mouse Alexa 546 and goat anti-rabbit Alexa
488 at 1:1000. Images were taken with a Zeiss LSM 510 laser scanning confocal
microscope. To visualise F-actin, cells were fixed in 4% formaldehyde at
25°C and stained with rhodamine phalloidin
(Sawin and Nurse, 1998
). Cells
were visualised using a Zeiss Axioplan microscope mounted with a mercury
lamp.
Immunoblot analysis
Preparation of total boiled protein extracts, western blot analysis and
detection of proteins were carried out as previously described
(Yamaguchi et al., 2000
). The
result for Tea1p differs from previously published data
(Mata and Nurse, 1997
) and is
caused by a different extraction procedure. Mata collected the cells, boiled
them and broke the cells using glass beads, he then spun the samples and only
took the supernatant for further analysis; we never spun the samples and
loaded the whole extract onto the gel.
SDS-polyacrylamide gels for Tea1p and Tip1p were prepared using a 203.25/1,
mono/bisacrylamide mix and samples were run on long gels. The antibodies used
were polyclonal anti-Tea1 at 1:1000 (Mata
and Nurse, 1997
), anti-Tip1 at 1:2000
(Brunner and Nurse, 2000a
) and
polyclonal anti-GFP at 1:1000 (a gift from Ken Sawin, Wellcome Trust Centre
for Cell Biology, Institute of Cell and Molecular Biology, University of
Edinburgh, UK). Pom1HA was detected with monoclonal 16B12 anti HA at 1:2000
(BABCO).
Phosphatase assay
Native cell extracts were made as described
(Yamaguchi et al., 2000
) in HB
buffer (25 mM MOPS pH 7.2, 15 mM MgCl2, 15 mM EGTA, 1 mM DTT, 1 %
Triton X-100) with the Protease Inhibitor Set (Roche). Cell extracts were then
incubated with Lambda Phosphatase (New England Biolabs) in its buffer
supplemented with MnCl for 25 minutes at 30°C in the presence or absence
of phosphatase inhibitors (60 mM ß-glycerophosphate, 12 mM
p-nitrophenylphosphate, 0.1 mM sodium vanadate). The reactions were stopped by
the addition of 2x sample buffer and boiling for 3 minutes.
Assay of Tea1GFP binding to microtubules
A cdc25-22 cyr1
sxa2
culture was grown overnight at
25°C to 4x106 cells/ml, shifted to 36°C for 90
minutes to arrest cells in G2 and then 3 µg/ml of P factor was added. After
a further 2 hours, the cells were shifted to 25°C for 2 hours and 20
minutes to allow progression into G1. Samples were taken for microtubular
repolymerisation at 90 minutes, just before the shift-down and at the end of
the time course.
25 µg/ml of MBC (Carbendazim) (added from a 5 mg/ml freshly made stock in DMSO) was added to a cell culture for 10 minutes at 36°C or 15 minutes at 25°C to totally depolymerise microtubules. To visualise tubulin, cells were collected onto Millipore filters (0.45 µm pore size) and washed for 50 seconds with minimal medium without MBC to allow partial repolymerisation of the microtubules. The filters were then dropped into 20 ml of -70°C methanol to fix the cells, which were then processed as described for tubulin immunofluorescence. For visualisation of Tea1GFP in live cells, 50 µl of cells with MBC were placed on 35 mm glass bottom dishes (MatTek Corporation) coated with 20 µg/ml Soybean Lectin (Biochem), which allows the cells to stick without moving while the media is changed. The dish with the cells was placed on an inverted LSM 510 confocal microscope and 1 ml of preconditioned media without MBC was added to the dish. This diluted the MBC to a concentration that allowed microtubules to repolymerise, and the cells were imaged 50 seconds later. For experiments carried out at 36°C, the dishes were pre-heated to 36°C before adding the cells, all media and dishes were kept at 36°C in a heating block and the microscope and stage used were inside a chamber heated to 36°C.
Live GFP microscopy
Cells were mounted on a glass slide in a volume of growth medium sufficient
to trap but not to squeeze the cells. Cells were visualised with a Zeiss LSM
510 laser scanning confocal microscope. A GFP specific filter was used to
visualise GFP alone. For colocalisation, a single section through the middle
of the cell was taken using a YFP optimised filter set to visualise Tip1YFP
and a CFP optimised filter set for Tea2GFP and Tea1GFP. YFP was excited at 514
nm and detected with a LP530 filter; GFP was excited at 458 nm and detected
with a LP475 filter. The images were collected by line scanning and the two
channels were excited sequentially at very high speed. Because of laser
variability the amplitude gain and the offset were adjusted every time to
ensure that there was no significant crossover between channels and all
imaging was then carried out with the same settings. Pom1GFP and phase images
were taken using a Zeiss Axioplan microscope mounted with a Hamamatsu
camera.
| Results |
|---|
|
|
|---|
sxa2
strain
(Imai and Yamamoto, 1994
|
Initially we examined the levels of Tea1p, Tea2p and Tip1p by western
blotting at different time points after pheromone addition and found that they
remain essentially constant during the pheromone time course
(Fig. 2A). The only change we
detected was a slightly different band pattern for Tip1p and Tea1p after 2.5
hours in pheromone (marked by arrows in
Fig. 2A,B). Phosphatase
treatment suggests that the new faster migrating form for Tea1p may be due to
dephosphorylation (Fig. 2C). We
conclude that all three proteins are present in the cell during shmooing
growth, although they might be differentially phosphorylated compared with
vegetatively growing cells. The result for Tea1p differs from previously
published data (Mata and Nurse,
1997
), and is due to a more complete extraction procedure during
the sample preparation in the present study (see Materials and Methods for
details)
|
|
cells. Cells with Tea2GFP appear to be
wild-type during vegetative (Browning et
al., 2000
During vegetative growth, Tea1GFP, Tip1YFP and Tea2GFP localise to cell
ends and to a few dots on microtubules (R. Bahrens, personal communication; A.
Decottignie, personal communication)
(Browning et al., 2000
).
After pheromone addition, Tea1GFP became mostly lost from the growing end and was redistributed along the cell periphery at the nongrowing larger end (Fig. 3E). After pheromone addition, Tea2GFP and Tip1YFP were also reduced at the growing end, accumulating at the non-growing end and in the cytoplasm, often as dots in a row (Fig. 3E). The same relocalisation was observed for Tea2GFP during an h90 mating. In conjugating cells, Tea2GFP was found to localise to the nongrowing ends with some dots in the cytoplasm (Fig. 3D). This demonstrates that the delocalisation of these factors is also observed in cells undergoing normal conjugation. We conclude that Tea1p, Tea2p and Tip1p are no longer specifically located at the growing ends of shmooing cells, and therefore their role in polarising cellular growth in these cells may not be the same as that in vegetatively growing cells.
|
Tea2p and Tip1p are known to be associated during the vegetative cell cycle
(D. Brunner, personal communication) and Tea2p may be the motor protein that
transports Tea1p to the ends of the cell
(Browning et al., 2000
). These
factors might therefore colocalise during vegetative growth and, if they no
longer have a role in shmooing growth, their association might fall apart.
Visualisation of Tea2GFP in combination with Tip1YFP revealed that Tea2p
always co-localises with Tip1p in the presence and absence of pheromone
(Fig. 3B). In contrast,
analysis of Tea1GFP in combination with Tip1YFP revealed that there is a
tenfold increase in the number of Tea1GFP dots that do not co-localise with
Tip1YFP in the presence of pheromone (Fig.
3A, Table 2). Most
of the free Tea1p dots localise to the peripheral region near the non-growing
end (Fig. 3A). The Tea1p in the
cytoplasm may still be on microtubules where it is co-localised with Tip1p,
but once it reaches the cell end it diffuses along the periphery of the cell
while Tip1p remains more concentrated at the cell tip. Therefore, during
shmooing growth the colocalisation of Tip1p and Tea2p is maintained, but the
colocalisation of Tea1p and Tip1p, and by inference Tea1p and Tea2p, is
reduced.
|
Tea1p association with microtubules
It is thought that cells predominantly respond to pheromone in the G1 phase
of the cell cycle (Stern and Nurse,
1998
). Therefore, when cells enter G1 in the presence of
pheromone, the properties of microtubules or Tea1p may be altered, reducing
the association between them. To test this possibility, we compared the
efficiency of Tea1p binding to re-polymerising microtubules in G2 arrested
cells that do not respond to pheromone, and in G1 cells that do respond to
pheromone. Live Tea1GFP images (Fig.
4Ea,b) during a G2 block, in the absence and presence of
pheromone, show short linear arrays of dots, which are similar to the
re-polymerising microtubule arrays seen by tubulin immunostaining
(Fig. 4Da,b) of the same
population. This suggests that Tea1GFP may co-localise with re-polymerising
microtubules. On the contrary, when cells enter G1 and become responsive to
pheromone, Tea1GFP is no longer found on re-polymerising microtubules
(Fig. 4Dc, Ec).
|
We confirmed that the Tea1GFP dots corresponded with microtubules in G2 arrested cells by repeating the experiment using an untagged tea1 strain, fixing the cells in methanol and co-staining for tubulin and Tea1p in the same cells. Cells arrested in G2 without pheromone (Fig. 4A) and G2 cells with pheromone (Fig. 4B) show Tea1p on microtubules. As before, after entry into G1 in the presence of pheromone (Fig. 4C), Tea1p is not found on microtubules.
The lack of association of Tea1p with microtubules in cells responsive to pheromone could mean that Tea1p is no longer efficiently transported along microtubules and so does not accumulate at the growing end of the cell. In contrast, Tip1p can still associate with growing microtubules in G1 cells treated with pheromone (Fig. 4F), and therefore a lack of microtubular association is unlikely to be the reason for Tip1p not being found at growing cell ends.
Phenotype of cells lacking Tea1p, Tea2p and Tip1p
Since Tea1p, Tea2p and Tip1p are delocalised in response to pheromone, they
might no longer play a role during shmooing. To investigate this we examined
the microtubular phenotype in tea1
, tea2.1 and
tip1
cells treated with pheromone. Microtubules of
vegetatively growing tea1
cells are slightly longer than
wild-type and some can curl around their cell ends
(Mata and Nurse, 1997
)
whereas, in tea2.1 (a null mutant) and tip1
cells,
microtubules are shorter and rarely reach the cell ends
(Verde et al., 1995
;
Browning et al., 2000
;
Brunner and Nurse, 2000a
). If
these factors no longer have a role during shmooing growth, then microtubules
should look like wild-type after pheromone treatment. This was indeed the
case. All three mutants were able to detect and respond to pheromone by
arresting in G1, as shown by FACS analysis
(Fig. 6B), and displayed
wild-type microtubules (Fig. 5;
Tables 3,
4). Control cells arrested in
HU still showed the mutant phenotype, which demonstrated that the effect was
not related to cell elongation.
|
|
|
|
During vegetative growth, Tea1p, Tip1p and Tea2p also affect the ability of
a cell to position a growth zone correctly
(Browning et al., 2000
;
Brunner and Nurse, 2000a
;
Mata and Nurse, 1997
).
Therefore we investigated the ability of the three null mutants to correctly
reorganise a single growth zone during the switch from vegetative to shmooing
growth. Vegetatively growing cells mostly extend in a bipolar fashion
(Mitchison and Nurse, 1985
),
whereas shmooing cells set up a single growth zone
(Petersen et al., 1998b
).
Actin mostly localises to sites of active growth and is usually localised to
both ends of vegetative cells (Marks and
Hyams, 1985
), but only to one end during shmooing growth
(Petersen et al., 1998b
).
After pheromone addition cells switch from a vegetative bipolar actin
localisation to a monopolar localisation. The relocalisation of actin can
therefore be taken as an indicator of the onset of shmooing. This assay allows
the switch between the bipolar actin localisation seen during vegetative
growth and the tight monopolar actin localisation seen during shmooing to be
monitored. Cells were scored as being monopolar only if they showed no actin
or only one actin dot at the other end. Most monopolar mutants,
tea1
included, are monopolar for growth and show actin mostly
localised at the growing end but often have a few dots of actin at the
nongrowing end and therefore would have been scored as bipolar. The assay
gives an accurate indication of the switch from vegetative growth to a
shmooing growth pattern, which shows no actin at all at the non-growing
end.
In vegetative wild-type cells actin was initially bipolar, and after 2.5
hours in pheromone it became monopolar in 50% of the cells
(Fig. 6A), indicating that half
of the cells have activated shmooing growth by 2.5 hours. In contrast, all
three mutants responded more rapidly, relocalising actin in 50% of the cells
within 1.5 hours (Fig. 6A).
These results show that Tea1p, Tea2p and Tip1p are not required to reorganise
a shmooing tip and, in fact, their presence can cause some delay in the switch
to the new growth mode. To analyse the effect of faster shmooing rates on
mating we scored the number of fused cells in a time course for mating in h90
wild-type and mutant strains. Tea2.1 and tip1
strains
mated faster than wild-type, suggesting that the faster shmooing rates may
lead to faster conjugation (Fig.
6C). In contrast, tea1
cells mated at the same
rate as wild-type. It is possible that Tea1p could be required for a
subsequent step in the mating pathway or for efficient arrest during nitrogen
starvation. In support of this we observed more septating cells in
tea1
than in wild-type after 6 hours without nitrogen (data
not shown).
Roles of microtubules and actin during shmooing
Next we decided to analyse the role of the cytoskeleton itself in the
shmooing process. First we tested whether properly organised actin was
required for shmooing. We depolymerised actin using the drug latrunculin A
(LatA), which inhibits actin polymerisation, and looked at the ability of the
cells to shmoo. Not surprisingly, since polymerised actin is known to be
essential for growth, cells were unable to shmoo in the presence of LatA
(Fig. 7A).
Next we examined the requirement for an intact microtubular cytoskeleton,
which is not essential for cell end extension during vegetative growth
(Sawin and Nurse, 1998
).
Since cells treated with pheromone at 36°C arrest in G1 with bipolar actin and do not activate monopolar shmooing growth (Fig. 7B,C), we could arrest cells at 36°C in the presence of pheromone, depolymerise microtubules with the drug MBC, and then release the cells at 25°C to allow them to activate shmooing growth in the absence of microtubules (Fig. 7D). We then monitored the rate of shmooing by looking at the relocalisation of actin from bipolar to monopolar. The switch from bipolar to monopolar actin localisation was unaffected by the absence of microtubules (Fig. 7D). This demonstrates that microtubules play no role in the establishment of a single polarised growth zone during shmooing. However, some T-shaped cells were observed (7%), similar to the proportion seen in vegetative growth in the presence of MBC (K. Sawin, personal communication), suggesting that microtubules may play some role in the correct positioning of a growth zone within the cell.
Pom1p does play a partial role in the switch to shmooing growth
We also examined the role of Pom1p in the pheromone response. Pom1p plays a
major role in the establishment of cell polarity
(Bahler and Pringle, 1998
);
acting downstream of Tea1p (Bahler and
Pringle, 1998
). The Pom1HA protein was still present during
shmooing growth (Fig. 8A), and
Pom1GFP, which is located at the cell ends during vegetative growth, became
distributed more generally throughout the cell after addition of pheromone
(Fig. 8B).
|
Next, we analysed the role of Pom1p by looking at the ability of
pom1
cells to shmoo. FACS analysis showed that the cells
responded to pheromone, arresting with similar kinetics to wild-type
(Fig. 8C). Actin was mostly
monopolar during vegetative growth but, as soon as pheromone was added, the
proportion of cells with monopolar actin dropped and that of cells with
delocalised actin increased (Fig.
8D). Close comparison of actin localisation for the first 2 hours
in a pom1
strain and wild-type
(Fig. 8E) showed a marked
difference between the two. In wild-type cells actin remained bipolar for the
first 1.5 hours whereas, in pom1
cells, delocalised actin
increased within 0.5 hours.
In wild-type monopolar cells actin becomes bipolar upon commitment to
mating, and then relocalises to the shmooing end
(Petersen et al., 1998b
).
Pom1p therefore may be required to maintain the cell end localisation of actin
during the early stages of the switch to shmooing growth. The subsequent
establishment of a monopolar localisation for actin was also slower and less
efficient in pom1
cells. Even after 6.5 hours, only 65% of the
cells were monopolar for actin and 27% of cells still had delocalised actin
whereas, by this time point, over 90% of wild-type cells were monopolar for
actin (Fig. 6).
| Discussion |
|---|
|
|
|---|
In vegetative growth, Tea1p is thought to be transported along microtubules in association with Tea2p and Tip1p. Live imaging data suggest that Tea1p and Tip1p mostly co-localise during vegetative growth, but in the presence of pheromone there is an increase in free Tea1p. Most free Tea1p is localised to sites near the cell cortex close to the non-growing end, suggesting that the complex is less strongly held together and falls apart when it reaches the cell ends. By contrast, Tip1p and Tea2p, which also co-localise during vegetative growth (D. Brunner, personal communication; this study), still co-localise in the presence of pheromone, suggesting that their association remains intact. These results support the idea that the association of Tea1p with Tip1p-Tea2p is not as strong during shmooing growth as it is during vegetative growth.
In response to pheromone, Tea1p also no longer appears to be associated
efficiently with microtubules and this could explain why Tea1p does not
accumulate at the cell ends. Preventing a cell end marker for vegetative
growth, such as Tea1p, from reaching cell ends may be an important step in the
initial dismantling of the intrinsic growth mechanism, allowing the assembly
of a new polarised projection directed by an extrinsic signal. Since Tea1p may
act as an anchoring factor for Tea2p and Tip1p at the cells ends
(Browning et al., 2000
;
Brunner and Nurse, 2000a
), the
loss of Tea1p from the growing end may also stop the cell end accumulation of
Tea2p and Tip1p. The microtubular dynamics might also be different during
shmooing, since their appearance is different, and this could contribute to
the loss of morphological factors from one end. The loss of association
between Tea1p and microtubules was only observed in G1 and not G2 cells with
pheromone, suggesting that the decision to set up a new, shmooing polarised
projection or to maintain the old vegetative growth pattern is made during
G1.
In the presence of pheromone, tea
, tip1
and tea2.1,
all of which have microtubule defects during vegetative growth, exhibit
wild-type microtubules, suggesting that Tea1p, Tea2p and Tip1p do not play a
major role in regulating microtubular dynamics during shmooing. In fact, the
presence of these factors seems to be inhibitory for shmooing growth as, in
response to pheromone, all the mutants set up the new shmooing pattern of
growth faster than the wild-type. FACS analysis showed that the mutants
arrested with similar kinetics to wild-type cells, indicating that the
response to pheromone occurs normally, and that it is only the switch to
shmooing growth that is accelerated in these mutants. In the absence of any of
these factors the vegetative system is probably partially defective and can be
dismantled more easily, allowing the new mode of growth to be activated
faster.
We found that microtubules themselves are not essential for the
organisation of a single polarised projection. However, the generation of some
T-shaped cells in the absence of microtubules, suggests that microtubules
might play some role in the correct positioning of the growth zone during
shmooing. Microtubules could also play a role in directing the polarised
projection towards the pheromone source, but this possibility requires further
investigation. Disrupting microtubules with TBZ concomitant with nitrogen
starvation totally inhibits projection tip formation
(Petersen et al., 1998a
). This
may be due to the fact that actin, as well as microtubules, is disrupted in
the presence of TBZ (K. Sawin, personal communication), and lower amounts of
TBZ were found to lead to the formation of H-shaped zygotes
(Petersen et al., 1998a
).
Using LatA we found that actin was completely essential for a polarised
projection to be formed, in agreement with previously published data
(Petersen et al., 1998b
).
After addition of pheromone to cells, actin first becomes bipolar and then
relocalises to the shmooing end (Petersen
et al., 1998b
). This may be an initial re-setting step, which
allows the cell to pick either end for shmooing growth, depending on which one
is experiencing the higher pheromone concentration. Pom1p may be important for
marking the cell ends for this initial relocalisation step since actin does
not become bipolar in pom1
cells after pheromone addition. The
subsequent relocalisation to one end is not as efficient as in wild-type
cells, but this could be a consequence of the initial actin
delocalisation.
We have shown that the morphological factors, Tea1p, Tea2p, Tip1p and
Pom1p, involved in setting up and maintaining an internally established axis
for vegetative cell growth are not required for shmooing growth. This probably
reflects a fundamental difference in the way cell polarity is established
during the two growth modes. In vegetative growth the landmarks for cell
polarisation are set up internally and once the cell shape has been
established the cell must be able to read that shape and maintain it. The
microtubular dynamics and the ability of the cell to remember its previous
ends appear to be suited for this purpose. During shmooing, the landmark for
growth is positioned by an external signal so the cell needs to recognise that
signal and position its growth site accordingly, thus altering its current
cell shape. The externally directed machinery will have to alter rather than
maintain cell shape. It will be interesting to establish whether, like S.
cerevisiae (Nern and Arkowitz,
2000
; O'Shea and Herskowitz,
2000
; Shimada et al.,
2000
), there is a core polarisation machinery, which is directed
to the internal landmarks during vegetative growth and to the externally
marked site during shmooing growth.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Arellano, M., Coll, P. M. and Perez, P. (1999). RHO GTPases in the control of cell morphology, cell polarity, and actin localisation in fission yeast. Microsc. Res. Tech. 47, 51-60.[Medline]
Bahler, J. and Nurse, P. (2001) Fission yeast Pom1p kinase activity is cell cycle regulated and essential for cellular symmetry during growth and division. EMBO J. 20,1064 -1073[Medline]
Bahler, J. and Pringle, J. R. (1998). Pom1p, a
fission yeast protein kinase that provides positional information for both
polarised growth and cytokinesis. Genes Dev.
12,1356
-1370.
Bahler, J., Wu, J.-Q., Longtine, M. S., Shah, N. G., McKenzie A., III, Steever, A. B., Wach, A., Philippsen, P. and Pringle, J. R. (1998) Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14,943 -951.[Medline]
Browning, H., Hayles, J., Mata, J., Aveline, L., Nurse, P. and
McIntosh, J. R. (2000). Tea2p is a kinesin-like protein
required to generate polarised growth in fission yeast. J. Cell
Biol. 151,15
-28.
Brunner, D. and Nurse, P. (2000a). CLIP170-like tip1p spatially organises microtubular dynamics in fission yeast. Cell 102,695 -704.[Medline]
Brunner, D. and Nurse, P. (2000b). New concepts in fission yeast morphogenesis. Philos. Trans. R Soc. Lond. B Biol. Sci. 355,873 -877.[Medline]
Cabib, E., Drgonova, J. and Drgon, T. (1998). Role of small G proteins in yeast cell polarisation and wall biosynthesis. Annu. Rev. Biochem. 67,307 -333.[Medline]
Chant, J. and Herskowitz, I. (1991). Genetic control of bud site selection in yeast by a set of gene products that constitute a morphogenetic pathway. Cell 65,1203 -1212.[Medline]
Chausovsky, A., Bershadsky, A. D. and Borisy, G. G. (2000). Cadherinmediated regulation of microtubule dynamics. Nat. Cell Biol. 2,797 -804.[Medline]
Chenevert, J. (1994). Cell polarisation directed by extracellular cues in yeast. Mol. Biol. Cell 5,1169 -1175[Medline]
Decottignies, A., Zarzov, P. and Nurse, P. (2001). In vivo localisation of fission yeast cyclin-dependent kinase cdc2p and cyclin B during mitosis and meiosis. J. Cell Sci. 114,2627 -2640.
Drubin, D. G. and Nelson, W. J. (1996). Origins of cell polarity. Cell 84,335 -344.[Medline]
Drummond, D. R. and Cross, R. A. (2000). Dynamics of interphase microtubules in Schizosaccharomyces pombe. Curr. Biol. 10,766 -775.[Medline]
Egel, R. (1971). Physiological aspects of conjugation in fission yeast. Planta 98, 89-96.
Egel, R. (1989). Mating-Type Genes, Meiosis and Sporulation. New York: Academic Press.
Fukui, Y., Kaziro, Y. and Yamamoto, M. (1986). Mating pheromone like diffusible factor released by Schizosaccharomyces pombe. EMBO J. 5,1991 -1993.[Medline]
Gutz, H. and Doe, F. J. (1975). On homo- and heterothallism in Schizosaccharomyces pombe. Mycologia 67,748 -759.
Hagan, I. M. (1998). The fission yeast microtubule cytoskeleton. J. Cell Sci. 111,1603 -1612.[Abstract]
Hagan, I. M. and Hyams, J. S. (1988). The use
of cell division cycle mutants to investigate the control of microtubule
distribution in the fission yeast Schizosaccharomyces pombe. J.
Cell Sci. 89,343
-357.
Hartwell, L. H. (1971). Genetic control of the cell division cycle in yeast. IV. Genes controlling bud emergence and cytokinesis. Exp. Cell Res. 69,265 -276.[Medline]
Imai, Y. and Yamamoto, M. (1994). The fission
yeast mating pheromone P-factor: its molecular structure, gene structure, and
ability to induce gene expression and G1 arrest in the mating partner.
Genes Dev. 8,328
-338.
Johnson, D. I. (1999). Cdc42: An essential
Rho-type GTPase controlling eukaryotic cell polarity. Microbiol.
Mol. Biol. Rev. 63,54
-105.
Kawamukai, M., Ferguson, K., Wigler, M. and Young, D. (1991). Genetic and biochemical analysis of the adenylyl cyclase of Schizosaccharomyces pombe. Cell Regul. 2, 155-164.[Medline]
Kitamura, K. and Shimoda, C. (1991). The Schizosaccharomyces pombe mam2 gene encodes a putative pheromone receptor which has a significant homology with the Saccharomyces cerevisiae Ste2 protein. EMBO J. 10,3743 -3751.[Medline]
Leupold, U. (1987). Sex appeal in fission yeast. Curr. Genet. 12,543 -545.
Marks, J. and Hyams, J. S. (1985). Localisation of F-actin through the cell-division cycle of Schizosaccharomyces pombe.Eur. J. Cell Biol. 39,27 -32.
Marks, J., Hagan, I. M. and Hyams, J. S. (1986). Growth polarity and cytokinesis in fission yeast: the role of the cytoskeleton. J. Cell Sci. Suppl. 5, 229-241.[Medline]
Mata, J. and Nurse, P. (1997). Tea1 and the microtubular cytoskeleton are important for generating global spatial order within the fission yeast cell. Cell 89,939 -949.[Medline]
Miller, P. J. and Johnson, D. I. (1994). Cdc42p
GTPase is involved in controlling polarised cell growth in
Schizosaccharomyces pombe. Mol. Cell. Biol.
14,1075
-1083.
Mitchison, J. M. and Nurse, P. (1985). Growth in cell length in the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 75,357 -376.[Abstract]
Nern, A. and Arkowitz, R. A. (2000).
Nucleocytoplasmic shuttling of the Cdc42p exchange factor Cdc24p.
J. Cell Biol. 148,1115
-1122.
Nielsen, O. and Davey, J. (1995). Pheromone communication in the fission yeast Schizosaccharomyces pombe. Semin. Cell Biol. 6,95 -104.[Medline]
O'Shea, E. K. and Herskowitz, I. (2000). The ins and outs of cell-polarity decisions. Nat. Cell Biol. 2,E39 -E41.[Medline]
Ottilie, S., Miller, P. J., Johnson, D. I., Creasy, C. L., Sells, M. A., Bagrodia, S., Forsburg, S. L. and Chernoff, J. (1995). Fission yeast park1+ encodes a protein kinase that interacts with Cdc42p and is involved in the control of cell polarity and mating. EMBO J. 14,5908 -5919.[Medline]
Petersen, J., Heitz, M. J. and Hagan, I. M. (1998a). Conjugation in S. pombe: identification of a microtubule-organising centre, a requirement for microtubules and a role for Mad2. Curr. Biol. 8,963 -966.[Medline]
Petersen, J., Nielsen, O., Egel, R. and Hagan, I. M. (1998b). F-actin distribution and function during sexual differentiation in Schizosaccharomyces pombe. J. Cell Sci. 111,867 -876.[Abstract]
Sawin, K. E. and Nurse, P. (1998). Regulation
of cell polarity by microtubules in fission yeast. J. Cell
Biol. 142,457
-471.
Shimada, Y., Gulli, M. P. and Peter, M. (2000). Nuclear sequestration of the exchange factor Cdc24 by Far1 regulates cell polarity during yeast mating. Nat. Cell Biol. 2, 117-124.[Medline]
Spencer, J. A., Eliazer, S., Ilaria, R. L., Jr, Richardson, J.
A. and Olson, E. N. (2000). Regulation of microtubule
dynamics and myogenic differentiation by MURF, a striated muscle RING-finger
protein. J. Cell Biol.
150,771
-784.
Stern, B. and Nurse, P. (1997). Fission yeast pheromone blocks S-phase by inhibiting the G1 cyclin B- p34cdc2 kinase. EMBO J. 16,534 -544.[Medline]
Stern, B. and Nurse, P. (1998). Cyclin B
proteolysis and the cyclin-dependent kinase inhibitor rum1p are required for
pheromone-induced G1 arrest in fission yeast. Mol. Biol.
Cell 9,1309
-1321.
Taheri, N., Kohler, T., Braus, G. H. and Mosch, H. U. (2000). Asymmetrically localized Bud8p and Bud9p proteins control yeast cell polarity and development. EMBO J. 19,6686 -6696.[Medline]
van Eeden, F. and St Johnston, D. (1999). The polarisation of the anterior-posterior and dorsal-ventral axes during Drosophila oogenesis. Curr. Opin. Genet. Dev. 9, 396-404.[Medline]
Verde, F., Mata, J. and Nurse, P. (1995). Fission yeast cell morphogenesis: identification of new genes and analysis of their role during the cell cycle. J. Cell Biol. 6,1529 -1538.
Woods, A., Sherwin, T., Sasse, R., MacRae, T. H., Baines, A. J.
and Gull, K. (1989). Definition of individual components
within the cytoskeleton of Trypanosoma brucei by a library of monoclonal
antibodies. J. Cell Sci.
93,491
-500.
Yamaguchi, S., Okayama, H. and Nurse, P. (2000). Fission yeast Fizzy-related protein srw1p is a G(1)-specific promoter of mitotic cyclin B degradation. EMBO J. 19,3968 -3977.[Medline]
This article has been cited by other articles:
![]() |
A. Sakaguchi, T. Miyaji, G. Tsuji, and Y. Kubo Kelch Repeat Protein Clakel2p and Calcium Signaling Control Appressorium Development in Colletotrichum lagenarium Eukaryot. Cell, January 1, 2008; 7(1): 102 - 111. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yamashita and M. Yamamoto Fission Yeast Num1p Is a Cortical Factor Anchoring Dynein and Is Essential for the Horse-Tail Nuclear Movement During Meiotic Prophase Genetics, July 1, 2006; 173(3): 1187 - 1196. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Browning and D. D. Hackney The EB1 Homolog Mal3 Stimulates the ATPase of the Kinesin Tea2 by Recruiting It to the Microtubule J. Biol. Chem., April 1, 2005; 280(13): 12299 - 12304. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Niccoli, A. Yamashita, P. Nurse, and M. Yamamoto The p150-Glued Ssm4p regulates microtubular dynamics and nuclear movement in fission yeast J. Cell Sci., November 1, 2004; 117(23): 5543 - 5556. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Feierbach, F. Verde, and F. Chang Regulation of a formin complex by the microtubule plus end protein tea1p J. Cell Biol., June 7, 2004; 165(5): 697 - 707. [Abstract] [Full Text] [PDF] |
||||
| |||||||||