|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
Department of Molecular and Cellular Physiology, Stanford University School of Medicine, Stanford, CA 94305-5435, USA
* Author for correspondence (e-mail: angelab{at}stanford.edu )
Accepted 13 January 2002
| Summary |
|---|
|
|
|---|
Key words: Adenomatous polyposis coli, End-binding protein 1, Microtubules
| Introduction |
|---|
|
|
|---|
Overexpression of APC or C-terminal APC fragments causes APC accumulation
at the plus end of MTs, and this accumulation has been attributed to APC
binding to EB1 (Askham et al.,
2000
; Mimori-Kiyosue et al.,
2000a
). EB1 (Su et al.,
1995
) binds to distal (plus) ends of interphase MTs
(Berrueta et al., 1998
;
Morrison et al., 1998
;
Mimori-Kiyosue et al., 2000b
)
and in vitro can promote MT polymerization in the presence of the
C-terminal-binding domain of APC (Nakamura
et al., 2001
).
The APC-EB1 complex may act as a MT capturing complex in interphase cells
that directs MT plus ends to specific cortical sites at the tip of extending
membranes. In yeast, the EB1 homologue Bim1p links MT plus ends to the
cortical protein Kar9p, which is localized to a defined area at the bud tip
(Korinek et al., 2000
;
Lee et al., 2000
;
Miller et al., 2000
).
Alternatively, an APC-EB1 complex at the plus ends of MT may link MT to a yet
unknown anchoring complex at the cortex; in this context, Kar9p localization
at the bud tip is independent of Bim1p
(Miller et al., 1999
;
Miller et al., 2000
).
Little is known about cortical APC cluster formation and the role of EB1 in determining APC localization in these clusters. Therefore, we have investigated which APC domains are involved in APC cluster localization and how this localization is affected by expression of EB1 mutant proteins. Our results show that the localization of APC in cortical clusters is different from that of EB1 at MT plus ends and further indicate that it is independent of EB1.
| Materials and Methods |
|---|
|
|
|---|
For construction of different APC expression vectors, pCDNAI/APC0-87
(kindly provided by Paul Polakis, Onyx Pharmaceuticals) was used as a
template. This vector encodes full-length human APC with a short additional
amino-acid sequence domain, inserted between amino acids 470 and 471 and
derived from exon 10A of the APC gene, which is found in some splice
variants of APC (Sulekova and Ballhausen,
1995
). For easier comparison, amino acid positions for human APC
are given without the `exon 10A' domain. Vectors for fluorescent proteins were
obtained from Clontech Laboratories, Inc. (Palo Alto, CA). Italic sequences in
the primers correspond to the respective APC or EB1 sequences. Underlined
sequences in the primers mark restriction sites used for cloning. All
constructs were confirmed by sequencing. For schematic representations of the
constructs, see Fig. 2.
|
GFP-APC (APC amino acids 1-2843): full-length APC was amplified by PCR with the 5' primer GATCGGAGCTCCAAGGATGGCTGCAGCTTCATATGATCAGTTG and the 3' primer GATCGGATCCAACAGATGTCACAAGGTAAGACCC and cloned SacI/BamHI into pEGFP-C1. GFP-APCwoE1 (GFP-APC without the internal EcoRI fragment; deletion of APC amino acids 221-2166): `in frame' ligation of the two internal EcoRI sites of the GFP-APC cDNA. GFP-APCE1X1 (APC amino acids 220-872): the APC internal 5' EcoRI/XmnI fragment was cloned into the EcoRI/SmaI sites of pEGFP-C3. APCARM-GFP (APC amino acids 461-777): part of the APC armadillo repeat domain was amplified by PCR with 5' primer AAGTCGACTCGAGGAATTCCCGCCACCATGGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTATTGCAAGTGG and 3' primer AAAGTCGACCTCTCGAGGGGATCCGTCTATATTGTCAAAAGTTTCTGATAAGTGCTGAGCATCTAATTCTGCTTC and cloned EcoRI/BamHI into pEGFP-N3. APCARM-Rep.-GFP (APC amino acids 504-77): a smaller part of the APC armadillo repeat domain was amplified by PCR with 5' primer AAGTCGACTCGAGGAATTCCCGCCACCATGGCTTTGACAAACTTGACTTTTGGAGATGTAGCCAACAAGGC and the same 3' primer as for APCARM-GFP and cloned EcoRI/BamHI into pEGFP-N3. GST-APCCT (APC amino acids 2672-2843): was amplified by PCR with 5' primer GAGCTCGTCGACGCCACCATGGGAAGATCTCCCACAGGTAATACTCCCCCGGTGATTG and 3' primer GAGCTCGCGGCCGCAGTCGACGGATCCAACAGATGTCACAAGGTAAGACCCAGAATGGCGCTTAGG and cloned SalI into pGEX-6P-3 (Amersham Pharmacia) for the expression of glutathione S-transferase (GST) fusion protein in bacteria.
EB1 cDNA's were obtained by PCR amplification from a HeLa cDNA library (Clontech) and cloned into pCR4BluntTOPO (Invitrogen, Carlsbad, CA) as described by the manufacturer. Full-length human EB1, encoding 268 amino acids, was amplified by PCR with 5' primer GGATCCGGTACCGTCGACGAATTCGCCACCATGGCAGTGAACGTATACTCAACGTCAGTGACCAGTG and 3' primer GTCGACGGTACCGGATCCTCTAGATTAATACTCTTCTTGCTCCTCCTGTGGGCCCCCTTCAT. EB1NT (amino acids 1-154) was amplified with the same 5 primer as full-length EB1 and 3' primer GTCGACGGTACCGGATCCTCTAGATTAAGTGAGAGGTTTCTTCGGTTTATTCAGAGCTGGAGCAAC. EB1 and EB1NT were cloned KpnI/BamHI into pDsRed-C1 for the expression of fluorescent fusion proteins in MDCK cells and were cloned BamHI/XbaI into pMAL (New England Biolabs) for the expression of Maltose-binding protein (MBP) fusion proteins in bacteria. EB1CT (amino acids 134-268) was amplified with 5' primer GGATCCGGTACCGTCGACGAATTCGCCACCATGGAAACTGCAGTGGCTCCTTCCCTTGTTGCTCCAG and the same 3'primer as full-length EB1. EB1CT was cloned SalI/BamHI into pDsRed-C1 and EcoRI /XbaI into pMal.
Antibodies
The following antibodies and dilutions were used: polyclonal rabbit
antiserum to a central APC domain
(Näthke et al., 1996
) at
a 1:200 dilution; mouse monoclonal antibody to EB1 (clone Ab-1; Oncogene
Research Products) at 2 µg/ml (immunoblotting showed that the antibody
recognizes EB1 and EB1CT, but not EB1NT (AB, unpublished result)); and, mouse
monoclonal antibody to ß-tubulin (clone TUB2.1; Sigma) at 1:100. For
immunoaffinity purification of GST fusion proteins, rabbit polyclonal antisera
to the C-terminus of APC (clone C20; Santa Cruz Biotechnology, Inc.) and to
glutathione S-transferase (clone GST Z-5; Santa Cruz Biotechnology, Inc.) were
used.
Immunofluorescence microscopy
2x105 MDCK cells were seeded onto 22x22 mm
collagen-coated coverslips in 35 mm tissue culture dishes and fixed 12 to 16
hours later. Cells were rinsed once in PBS pH 7.4 (2.7 mM KCl, 1.5.mM
KH2PO4, 1.5 mM MgCl2, 1 mM EGTA, 137 mM NaCl
and 8.1 mM NaHPO4), fixed for 5 minutes in -20°C methanol and
then rinsed once in PBS with 0.1% Triton-X-100. Cells were washed three times
in PBS and blocked for 20 minutes at room temperature in PBS with 1% BSA and
2% goat serum. Cells were labeled for immunofluorescence as described
elsewhere (Barth et al., 1997b
)
and analyzed with a Delta VisionTM full-spectrum optical sectioning
microscope system (Applied Precision, Inc., Seattle, WA; Beckman Center Cell
Sciences Imaging Facility). The percentage of cortical APC clusters that had
total or partial overlap with EB1 was determined in basal sections of 10 MDCK
cells, which had a total of 15 cluster areas immunolabelled for endogenous APC
and EB1.
Protein-binding assay
Bacterial cultures were resuspended in 50 mM Tris pH 8, 2 mM EDTA, 0.1%
Triton-X-100, 1mM DTT and complete protease inhibitor cocktail (Roche
Molecular Biochemicals), then lysed with a French press (ThermoSpectronic,
Rochester, NY). GST or MBP fusion proteins were purified with
glutathione-sepharose (Sigma) or amylose-resin (New England Biolabs) according
to the manufacturer's instructions. GST-APCCT was further purified by
immunoprecipitation with anti-APC C20 (Santa Cruz Biotechnology, Inc) bound to
protein A-sepharose (Amersham Pharmacia), and GST was further purified by
immunoprecipitation with anti-GST Z-5 (Santa Cruz Biotechnology, Inc).
Equivalent amounts of GST-APCCT or GST bound to the respective immunoaffinity
resins and, as a control, the immunoaffinity resins alone were incubated for 2
hours at 4°C with 20 µg MBP as a control or with 7 µg MBP-EB1 or
MBP-EB 1CT in 10 mM phosphate buffer pH 7.4, 2.7 mM KCl, 137 mM NaCl, 10 mM
maltose, 1% Triton-X-100, 1 mM DTT and then washed four times with 30 volumes
of the same buffer. Proteins bound to the immunoaffinity resins were analyzed
by SDS-PAGE as described previously (Barth
et al., 1997b
). Polyacrylamide gels were stained with with
Coomassie Brillant Blue R-250 and scanned with a ScanJet IIc (Hewlett-Packard
Co., Palo Alto, CA).
MT pelleting assay
Purified bovine brain tubulin (kindly provided by Eugenio de Hostos,
University of California, San Francisco) was polymerized in PEM (80 mM
Pipes/Dipotassium Salt pH 6.9, 1 mM MgCl2, 1 mM EGTA), 0.2 mM GTP
at a concentration of 5.5 µg/µl for 10 minutes at 37°C. Tubulin was
diluted to 1.1 µg/µl with PEM, 20 µM Taxol and incubated for another
10 minutes at 37°C. MBP fusion proteins in 10 mM phosphate buffer pH 7.4,
2.7 mM KCl, 137 mM NaCl, 10 mM maltose were pre-cleared by a 30 minute
centrifugation at 4°C and 200,000 g in a TL100 Ultracentrifuge
(Beckman). Taxol and MgCl2 were added to the fusion proteins to a
final concentration of 20 µM and 5 mM, respectively. 100 µl of
polymerized tubulin at a concentration of 1.1 µg/µl was mixed with 100
µl of MBP, MBP-EB1 or MBP-EB1CT fusion protein, respectively, and incubated
for 10 minutes at RT. Equivalent amounts of MBP-EB1 and MBP-EB1CT (
50
µg) were used in the assay. MBP fusion proteins bound to polymerized
tubulin were precipitated by centrifugation through a 30% glycerol cushion in
PEM, 5 µM Taxol, 1 mM Pefabloc (Roche Molecular Biochemicals) for 30
minutes, at RT at 160,000 g in a SW60 rotor (Beckman). After
centrifugation, the supernatant with the remaining tubulin-MBP fusion protein
solution and half of the cushion was removed and the centrifugation tubes were
washed twice with dH2O before complete removal of the residual
cushion. Pellets were resuspended in SDS-PAGE loading buffer and analyzed by
SDS-PAGE (Barth et al., 1997b
).
Polyacrylamide gels were stained with Coomassie Brilliant Blue R-250 and
scanned with a ScanJet IIc (Hewlett-Packard Co., Palo Alto, CA).
| Results and Discussion |
|---|
|
|
|---|
|
|
The N-terminal Armadillo repeat domain of APC is necessary and
sufficient for APC localization in cortical clusters
To define the APC domain required for APC localization in cortical
clusters, full-length APC and different domains of APC fused to GFP were
expressed in MDCK cells (Fig.
2). Full-length GFP-APC localized in cortical clusters into which
MTs terminated (Fig. 2a-c;
black arrowheads) and along MTs (Fig.
2a-c; white arrowheads). An APC mutant lacking a large central
part of the protein (GFP-APCwoE1) did not colocalize in cortical clusters
containing endogenous APC (Fig.
2d-f) even though GFP-APCwoE1 retains the N-terminal APC-APC
dimerization domain (Joslyn et al.,
1993
). However, GFP-APCwoE1 did localize along MTs
(Fig. 2d-f) probably through
its C-terminal MT- and/or EB1-binding domains.
Next, we examined the distribution of APC mutants lacking C-terminal MT-
and EB 1-binding domains. We made GFP-APC E1X1, which contains the highly
conserved APC domain and armadillo repeats 1-9 of 10 APC armadillo repeats as
defined by Huber and Weis (Huber and Weis,
2001
) including the `exon 10A' domain and APCARM-GFP, which
contains armadillo repeats 3-9. Both mutant proteins prominently colocalize
with endogenous cortical APC clusters, but neither protein localizes along MTs
(Fig. 2g-q). Expression of
APCARM-1.Rep-GFP, which contains armadillo repeats 4-9, strongly diminished,
but did not completely eliminate mutant protein localization to cortical
clusters of endogenous APC (Fig.
2r-t).
In summary, armadillo repeats 3-9 are necessary and sufficient to mediate
localization of APC to cortical clusters. In this context, it is interesting
to note that the cortical localization of Drosophila APC2 (E-APC) is
disrupted by a single point mutation in its armadillo region
(Townsley and Bienz, 2000
). At
present, we do not know whether these armadillo repeats are sufficient for de
novo assembly of cortical clusters of APC. Armadillo repeat domains in other
proteins have been shown to mediate protein-protein interactions between
diverse binding partners and, generally, more than one repeat is involved in
mediating a particular interaction
(Hülsken et al., 1994
;
Huber and Weis, 2001
).
Accordingly, a binding partner to the APC armadillo repeat domain may specify
a cortical targeting site for APC. As the armadillo repeat domain of APC is
sufficient to localize to APC clusters, it is possible that an unknown binding
partner of this domain is involved in APC cluster formation. One possibility
is the APC-stimulated Rac-specific guanine nucleotide exchange factor (Asef),
which is a binding partner for the APC armadillo repeat domain
(Kawasaki et al., 2000
).
However, overexpression of Asef causes dissociation of the cortical APC
clusters in MDCK cells (Kawasaki et al.,
2000
), perhaps by competing with another endogenous binding
partner and thereby disrupting APC cluster formation.
The C-terminal half of EB1 binds APC but not MTs
Although endogenous EB1 does not accumulate in cortical APC clusters and we
did not observe a concentration of endogenous APC at distal MTs ends
(Fig. 1), EB1 could facilitate
APC transport to cortical sites. In that case, expression of an EB1 mutant
protein that can bind to APC but is unable to bind to MTs should inhibit APC
cluster formation. The N-terminal half of EB1 is highly conserved and contains
the MT-binding site defined in the EB1 homologue RP1
(Juwana et al., 1999
). The
APC-binding domain in EB1 has not been defined, but Kar9p binding to the yeast
EB1 homologue Bim 1p is mediated by the C-terminal half of Bim 1p
(Miller et al., 2000
).
To identify a domain in EB1 that binds to APC but not MTs, the C-terminal half of EB1 (MBP-EB1CT) and, as a control, full-length EB1 (MBP-EB1) were purified as MBP fusion proteins from bacteria (Fig. 3a; lanes 1-3; Fig. 3b; lanes 13-15). Another EB1 mutant fusion protein containing the N-terminal half of EB1 (MBP-EB1NT) was also expressed but it could not be purified from bacteria. MBP-EB1 co-pelleted with polymerized bovine brain tubulin; only trace amounts of MBP-EB1CT and MBP were detected in the pellet (Fig. 3a, lanes 4-6).
|
To analyze internations of MBP-EB1 and MBP-EB1CT with APC, a C-terminal
domain of APC containing the EB1-binding region
(Askham et al., 2000
) was
purified as a glutathione S-transferase (GST) fusion protein from bacteria and
further purified by immunoaffinity precipitation with an antiserum to the
C-terminus of APC (Fig. 3b; lanes 7-9; GST-APCCT). Both MBP-EB1 and MBP-EB1CT, but not MBP, co-pelleted
with GST-APCCT (Fig. 3b; lanes
7-9). The MBP fusion proteins did not co-pellet with GST
(Fig. 3b; lanes 4-6) or with
the respective immunoaffinity resins alone
(Fig. 3b; lanes 1-3 and 10-12).
In summary, amino acids 134 to 268 in EB1CT bind to APC but not MTs. This
region in EB1 contains a domain with homology to the Kar9-binding site in the
yeast EB1 homologue Bim1p (Miller et al.,
2000
).
Subcellular localization of EB1 mutant proteins in MDCK cells
Full-length EB1 and EB1 mutant proteins were expressed in MDCK cells as
fusions to DsRed fluorescent protein (Figs
4,5).
Similar to endogenous EB1, DsRed-EB1 localized to MT distal (plus) ends
(arrows in Fig. 4a-c). However,
unlike endogenous EB1, DsRed-EB1 accumulated in cortical APC clusters
(Fig. 5a-c; white arrowheads),
probably because of an excess of EB1, which can then interact with additional
binding sites. In 44% of cells transiently transfected with DsRed-EB1, all
cortical APC clusters contained DsRed-EB1; in 19% of those cells some APC
clusters contained DsRed-EB1 and others did not; in 37% of those cells
DsRed-EB1 did not co-localize with cortical APC clusters (number of cells
analyzed n=111).
|
DsRed-EB1CT, which contains the APC-binding domain (Fig. 3), dominantly colocalized with endogenous APC in cortical clusters (Fig. 4d-f; Fig. 5g-i; white arrowheads). In all cells transiently transfected with DsRed-EB1CT, all cortical APC clusters contained DsRed-EB1CT (number of cells analyzed n=109). Note that expression of DsRed-EB1CT does not appear to disrupt APC cluster formation. Furthermore, DsRed-EB1CT had a diffuse cytoplasmic distribution and coaligned only occasionally with a few MT plus ends (Fig. 4d-f; compare DsRed-EB1 in 4b with DsRed-EB1CT in 4e), consistent with the lack of EB1CT binding to MTs in vitro (Fig. 3a). The weak residual localization of DsRed-EB1CT at MT plus ends may be caused by low amounts of APC in these areas (Fig. 4d-f; arrows).
DsRed-EB1NT, which contains the MT-binding domain, localized to MTs but was not as restricted to MT distal (plus) ends as endogenous EB1 (arrows in Fig. 4g-i) or DsRed-EB1 in cells expressing approximately the same levels of these fusion proteins (compare Fig. 4h with 4b) (data not shown). Significantly, DsRed-EB1NT did not colocalize with endogenous APC in cortical clusters (Fig. 5d-f; black arrowheads). The transfection efficiency for DsRed-EB1NT was lower than that of other EB1 proteins; only one third of the cells transfected with DsRed-EB1NT showed extensive filamentous DsRed-EB1NT localization that overlapped with MT plus ends marked by EB1 (Fig. 4g-i), whereas in two thirds of the transfected cells, DsRed-EB1NT distributed more diffusely throughout the cytoplasm. Therefore, this EB1 fragment may be less stable or less efficient in its binding properties than full-length EB1. However, DsRed-EB1NT did not localize to cortical APC clusters in any of the transfected cells (number of cells analyzed n=80; 29 of these cells showed filamentous DsRedEB1-NT distribution).
Since overexpression of EB1 mutant proteins did not have a disruptive
(dominant-negative) effect on the localization of endogenous APC to cortical
clusters, binding to EB1 does not appear to be essential for assembly of APC
into cortical clusters. The subcellular distributions of EB1-CT and -NT
mutants reflected their binding properties to APC and MTs, respectively. These
results show that cortical APC clusters and cortical EB1-containing MT plus
ends are spatially different structures (see also
Fig. 1 for endogenous APC and
EB1). Note, however, that we show in Fig.
1 and
2 that the APC clusters are
closely associated with EB1-containing MT plus ends and that we have
previously demonstrated that these clusters dissociate after
nocodazole-induced disassembly of MTs
(Näthke et al., 1996
).
Although the existence of cortical APC clusters is ultimately dependent on an
intact MT cytoskeleton (Näthke et
al., 1996
), the results shown here emphasize that these clusters
are not identical to a bundle of free cortical MT plus ends, but they seem to
contain additional organizing components that assemble them at particular
sites of the cortex. This is consistent with previously published results from
Mimori-Kiyosue et al. (Mimori-Kiyosue et
al., 2000a
), which show that after disruption of MTs, cortical APC
clusters do not disassemble immediately but redistribute along actin stress
fibers at the basal plasma membrane
(Mimori-Kiyosue et al.,
2000a
).
Cortical APC clusters at the tip of cell extensions have been correlated
with a role of APC in promoting cell extension and directed cell migration by
affecting MT dynamics in these areas (Barth
et al., 1997a
; Näthke et
al., 1997
; Pollack et al.,
1997
). Similar to the Kar9p-EB1 complex in mitotic yeast cells,
the APC-EB1 complex may act as a MT-capturing complex that redirects MT plus
ends to specific sites at the tip of extending membranes. However, the order
of assembly of the APC-EB1 complex is different from previous predictions
(Askham et al., 2000
;
Mimori-Kiyosue et al., 2000) and has similarity to the process in budding
yeast. In yeast, Kar9p assembly at the bud tip is independent of EB1
(Miller et al., 1999
;
Miller et al., 2000
).
Similarly, our results indicate that APC assembly into cortical clusters is
independent of EB1; our data indicate a role of the APC armadillo domain in
targeting APC to cortical clusters. Thus, EB1-containing MT plus ends may be
captured by preexisting cortical APC clusters, thereby causing the
reorientation of a subset of MTs towards that region of the membrane and the
formation/stabilization of a polarized membrane extension.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Askham, J. M., Moncur, P., Markham, A. F. and Morrison, E. E. (2000). Regulation and function of the interaction between the APC tumour suppressor protein and EB 1. Oncogene 19,1950 -1958.[Medline]
Barth, A. I., Nathke, I. S. and Nelson, W. J. (1997a). Cadherins, catenins and APC protein: interplay between cytoskeletal complexes and signaling pathways. Curr. Opin. Cell Biol. 9,683 -690.[Medline]
Barth, A. I., Pollack, A. L., Altschuler, Y., Mostov, K. E. and
Nelson, W. J. (1997b). NH2-terminal deletion of beta-catenin
results in stable colocalization of mutant beta-catenin with adenomatous
polyposis coli protein and altered MDCK cell adhesion. J. Cell
Biol. 136,693
-706.
Berrueta, L., Kraeft, S. K., Tirnauer, J. S., Schuyler, S. C.,
Chen, L. B., Hill, D. E., Pellman, D. and Bierer, B. E.
(1998). The adenomatous polyposis coli-binding protein EB 1 is
associated with cytoplasmic and spindle microtubules. Proc. Natl.
Acad. Sci. USA 95,10596
-10601.
Groden, J., Thliveris, A., Samowitz, W., Carlson, M., Gelbert, L., Albertsen, H., Joslyn, G., Stevens, J., Spirio, L., Robertson, M. et al. (1991). Identification and characterization of the familial adenomatous polyposis coli gene. Cell 66,589 -600.[Medline]
Huber, A. H. and Weis, W. I. (2001). The structure of the beta-catenin/E-cadherin complex and the molecular basis of diverse ligand recognition by beta-catenin. Cell 105,391 -402.[Medline]
Hülsken, J., Birchmeier, W. and Behrens, J.
(1994). E-cadherin and APC compete for the interaction with
beta-catenin and the cytoskeleton. J. Cell Biol.
127,2061
-2069.
Joslyn, G., Richardson, D. S., White, R. and Alber, T.
(1993). Dimer formation by an N-terminal coiled coil in the APC
protein. Proc. Natl. Acad. Sci. USA
90,11109
-11113.
Juwana, J. P., Henderikx, P., Mischo, A., Wadle, A., Fadle, N., Gerlach, K., Arends, J. W., Hoogenboom, H., Pfreundschuh, M. and Renner, C. (1999). EB/RP gene family encodes tubulin binding proteins. Int. J. Cancer 81,275 -284.[Medline]
Kawasaki, Y., Senda, T., Ishidate, T., Koyama, R., Morishita,
T., Iwayama, Y., Higuchi, O. and Akiyama, T. (2000). Asef, a
link between the tumor suppressor APC and G-protein signaling.
Science 289,1194
-1197.
Korinek, W. S., Copeland, M. J., Chaudhuri, A. and Chant, J.
(2000). Molecular linkage underlying microtubule orientation
toward cortical sites in yeast. Science
287,2257
-2259.
Lee, L., Tirnauer, J. S., Li, J., Schuyler, S. C., Liu, J. Y.
and Pellman, D. (2000). Positioning of the mitotic spindle by
a cortical-microtubule capture mechanism. Science
287,2260
-2262.
Mays, R. W., Siemers, K. A., Fritz, B. A., Lowe, A. W., van
Meer, G. and Nelson, W. J. (1995). Hierarchy of mechanisms
involved in generating Na/K-ATPase polarity in MDCK epithelial cells.
J. Cell Biol. 130,1105
-1115.
Miller, R. K., Cheng, S. C. and Rose, M. D.
(2000). Bim1p/Yeb1p mediates the Kar9p-dependent cortical
attachment of cytoplasmic microtubules. Mol. Biol.
Cell 11,2949
-2959.
Miller, R. K., Matheos, D. and Rose, M. D.
(1999). The cortical localization of the microtubule orientation
protein, Kar9p, is dependent upon actin and proteins required for
polarization. J. Cell Biol.
144,963
-975.
Mimori-Kiyosue, Y., Shiina, N. and Tsukita, S.
(2000a). Adenomatous polyposis coli (APC) protein moves along
microtubules and concentrates at their growing ends in epithelial cells.
J. Cell Biol. 148,505
-518.
Mimori-Kiyosue, Y., Shiina, N. and Tsukita, S. (2000b). The dynamic behavior of the APC-binding protein EB 1 on the distal ends of microtubules. Curr. Biol. 10,865 -868.[Medline]
Morrison, E. E., Wardleworth, B. N., Askham, J. M., Markham, A. F. and Meredith, D. M. (1998). EB 1, a protein which interacts with the APC tumour suppressor, is associated with the microtubule cytoskeleton throughout the cell cycle. Oncogene 17,3471 -3477.[Medline]
Munemitsu, S., Souza, B., Muller, O., Albert, I., Rubinfeld, B.
and Polakis, P. (1994). The APC gene product associates with
microtubules in vivo and promotes their assembly in vitro. Cancer
Res. 54,3676
-3681.
Nakamura, M., Zhou, X. Z. and Lu, K. P. (2001). Critical role for the EB 1 and APC interaction in the regulation of microtubule polymerization. Curr. Biol. 11,1062 -1067.[Medline]
Näthke, I. S., Adams, C. L., Polakis, P., Sellin, J. H. and
Nelson, W. J. (1996). The adenomatous polyposis coli tumor
suppressor protein localizes to plasma membrane sites involved in active cell
migration. J. Cell Biol.
134,165
-179.
Näthke, I. S., Barth, A. I. M. and Nelson, W. J. (1997). Role for the tumor suppressor adenomatous polyposis coli protein in epithelial migration and adhesion: a hypothesis. In Cytoskeletal-Membrane Interactions and Signal Transduction, 1st edn (ed. P. Cowin and M. W. Klymkowsky), pp.103 -110. New York: Chapman and Hall.
Polakis, P. (1999). The oncogenic activation of beta-catenin. Curr. Opin. Genet. Dev. 9, 15-21.[Medline]
Pollack, A. L., Barth, A. I. M., Altschuler, Y., Nelson, W. J.
and Mostov, K. E. (1997). Dynamics of ß-catenin
interactions with APC protein regulate epithelial tubulogenesis. J.
Cell Biol. 137,1651
-1662.
Su, L. K., Burrell, M., Hill, D. E., Gyuris, J., Brent, R.,
Wiltshire, R., Trent, J., Vogelstein, B. and Kinzler, K. W.
(1995). APC binds to the novel protein EB 1. Cancer
Res. 55,2972
-2977.
Sulekova, Z. and Ballhausen, W. G. (1995). A novel coding exon of the human adenomatous polyposis coli gene. Hum. Genet. 96,469 -471.[Medline]
Townsley, F. M. and Bienz, M. (2000). Actin-dependent membrane association of a Drosophila epithelial APC protein and its effect on junctional Armadillo. Curr. Biol. 10,1339 -1348.[Medline]
This article has been cited by other articles:
![]() |
K. Brandner, A. Sambade, E. Boutant, P. Didier, Y. Mely, C. Ritzenthaler, and M. Heinlein Tobacco Mosaic Virus Movement Protein Interacts with Green Fluorescent Protein-Tagged Microtubule End-Binding Protein 1 Plant Physiology, June 1, 2008; 147(2): 611 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Grohmann, K. Tanneberger, A. Alzner, J. Schneikert, and J. Behrens AMER1 regulates the distribution of the tumor suppressor APC between microtubules and the plasma membrane J. Cell Sci., November 1, 2007; 120(21): 3738 - 3747. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Hume, D. S. Ushakov, A. K. Tarafder, M. A. Ferenczi, and M. C. Seabra Rab27a and MyoVa are the primary Mlph interactors regulating melanosome transport in melanocytes J. Cell Sci., September 1, 2007; 120(17): 3111 - 3122. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Moseley, F. Bartolini, K. Okada, Y. Wen, G. G. Gundersen, and B. L. Goode Regulated Binding of Adenomatous Polyposis Coli Protein to Actin J. Biol. Chem., April 27, 2007; 282(17): 12661 - 12668. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Mimori-Kiyosue, C. Matsui, H. Sasaki, and S. Tsukita Adenomatous polyposis coli (APC) protein regulates epithelial cell migration and morphogenesis via PDZ domain-based interactions with plasma membranes. Genes Cells, February 1, 2007; 12(2): 219 - 233. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sharma, L. Leung, M. Brocardo, J. Henderson, C. Flegg, and B. R. Henderson Membrane Localization of Adenomatous Polyposis Coli Protein at Cellular Protrusions: TARGETING SEQUENCES AND REGULATION BY beta-CATENIN J. Biol. Chem., June 23, 2006; 281(25): 17140 - 17149. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kita, T. Wittmann, I. S. Nathke, and C. M. Waterman-Storer Adenomatous Polyposis Coli on Microtubule Plus Ends in Cell Extensions Can Promote Microtubule Net Growth with or without EB1 Mol. Biol. Cell, May 1, 2006; 17(5): 2331 - 2345. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Green, R. Wollman, and K. B. Kaplan APC and EB1 Function Together in Mitosis to Regulate Spindle Dynamics and Chromosome Alignment Mol. Biol. Cell, October 1, 2005; 16(10): 4609 - 4622. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Etienne-Manneville, J.-B. Manneville, S. Nicholls, M. A. Ferenczi, and A. Hall Cdc42 and Par6-PKC{zeta} regulate the spatially localized association of Dlg1 and APC to control cell polarization J. Cell Biol., September 12, 2005; 170(6): 895 - 901. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Noritake, T. Watanabe, K. Sato, S. Wang, and K. Kaibuchi IQGAP1: a key regulator of adhesion and migration J. Cell Sci., May 15, 2005; 118(10): 2085 - 2092. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Slep, S. L. Rogers, S. L. Elliott, H. Ohkura, P. A. Kolodziej, and R. D. Vale Structural determinants for EB1-mediated recruitment of APC and spectraplakins to the microtubule plus end J. Cell Biol., February 14, 2005; 168(4): 587 - 598. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kodama, T. Lechler, and E. Fuchs Coordinating cytoskeletal tracks to polarize cellular movements J. Cell Biol., October 25, 2004; 167(2): 203 - 207. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Nathke APC at a glance J. Cell Sci., October 1, 2004; 117(21): 4873 - 4875. [Full Text] [PDF] |
||||
![]() |
M. K. Temburni, M. M. Rosenberg, N. Pathak, R. McConnell, and M. H. Jacob Neuronal Nicotinic Synapse Assembly Requires the Adenomatous Polyposis Coli Tumor Suppressor Protein J. Neurosci., July 28, 2004; 24(30): 6776 - 6784. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Miller, Y. Wang, M. S. Mooseker, and A. J. Koleske The Abl-related gene (Arg) requires its F-actin-microtubule cross-linking activity to regulate lamellipodial dynamics during fibroblast adhesion J. Cell Biol., May 10, 2004; 165(3): 407 - 419. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Louie, S. Bahmanyar, K. A. Siemers, V. Votin, P. Chang, T. Stearns, W. J. Nelson, and A. I. M. Barth Adenomatous polyposis coli and EB1 localize in close proximity of the mother centriole and EB1 is a functional component of centrosomes J. Cell Sci., March 1, 2004; 117(7): 1117 - 1128. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hayashi and M. Ikura Crystal Structure of the Amino-terminal Microtubule-binding Domain of End-binding Protein 1 (EB1) J. Biol. Chem., September 19, 2003; 278(38): 36430 - 36434. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Askham, K. T. Vaughan, H. V. Goodson, and E. E. Morrison Evidence That an Interaction between EB1 and p150Glued Is Required for the Formation and Maintenance of a Radial Microtubule Array Anchored at the Centrosome Mol. Biol. Cell, October 1, 2002; 13(10): 3627 - 3645. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||