|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
1 Institute of Cell and Molecular Biology, University of Edinburgh, Edinburgh
EH9 3JR, UK
2 Sir Alastair Currie CRC Laboratories, Molecular Medicine Centre, University of
Edinburgh, Edinburgh EH4 2XU, UK
3 Cell Therapy Group, Scottish National Blood Transfusion Service, Edinburgh EH4
2XU, UK
4 John Hughes Bennett Laboratory, Department of Oncology, University of
Edinburgh, Edinburgh EH4 2XU, UK
* Author for correspondence (e-mail: David.Melton{at}ed.ac.uk
Accepted 6 January 2002
| Summary |
|---|
|
|
|---|
Key words: DNA ligases, DNA repair, DNA replication, Genome instability
| Introduction |
|---|
|
|
|---|
Inherited human disorders that result in chromosome instability and cancer
predisposition have been central to the understanding of many mammalian DNA
metabolism and repair pathways. The paradigm for genome instability disorders
is Bloom's syndrome (BS). Patients with BS have growth retardation, immune
deficiency and are predisposed to a range of cancers, and cells from BS
patients show a very high level of sister chromatid exchange, increased
mutation and somatic recombination rate and increased sensitivity to a range
of DNA damaging agents (German,
1993
). Although BS is caused by mutations in the BLM
helicase gene (Ellis et al.,
1995
), mutations in LIG1 were identified in a patient
with similar physical retardation, immune deficiency and hypersensitivity to
sunlight to patients with BS (Webster et
al., 1992
). A Glu566 to Lys mutation at the enzyme active site
inactivated one allele, whereas an Arg771 to Trp mutation on the second allele
resulted in 20-fold reduction in enzyme activity
(Barnes et al., 1992
). A
fibroblast cell line isolated from this patient (46BR) showed increased
sensitivity to a wide variety of DNA damaging agents, delayed joining of DNA
replication intermediates and increased somatic recombination, although not to
the level seen in BS (Teo et al.,
1983
; Lehmann et al.,
1988
; Prigent et al.,
1994
; Henderson et al.,
1985
). As a consequence, it was speculated that DNA ligase I plays
roles in multiple DNA replication, recombination and repair pathways.
There is a wealth of evidence confirming that DNA ligase I is the main
ligase involved in joining DNA replication intermediates. DNA ligase I
expression and activity correlate closely with the rate of cell proliferation;
the protein localises to multiprotein replication complexes and interacts with
proliferating cell nuclear antigen (PCNA) (e.g.
Levin et al., 2000
;
Tom et al., 2001
) and
functions in lagging-strand DNA replication in vitro
(Waga et al., 1994
). Perhaps
unsurprisingly, DNA ligase I has been reported to be an essential gene for
mammalian cells growing in vitro (Petrini
et al., 1995
). There is also strong evidence supporting the role
of DNA ligase I in the long-patch form of base excision repair (BER) (for a
review, see Lindahl et al.,
1997
), and it has also been implicated in nucleotide excision
repair (NER) by in vitro reconstitution
(Shivji et al., 1995
;
Aboussekhra et al., 1995
).
However, DNA ligase I is not the only DNA ligase that functions in BER. The
ubiquitously expressed form of DNA ligase III (IIIa) complexes with the
single-strand break repair protein, XRCC1, and is involved in the predominant
(short-patch) form of BER (Cappelli et al.,
1997
). Similarly, although DNA ligase I is active in a cell-free
V(D)J recombination system (Ramsden et
al., 1997
), it cannot carry out doublestrand break repair in
ligase IV-defective cells (Grawunder et
al., 1998
). Instead, cultured cells lacking DNA ligase IV are both
defective in V(D)J recombination and hypersensitive to ionising radiation
(Frank et al., 1998
). Hence
there is uncertainty about the roles of DNA ligase I in recombination and
repair and the level of redundancy with other DNA ligases.
To study the function of DNA ligase I in mammalian cells, and as the first
stage in the production of a mouse model for the 46BR patient, we knocked out
the mouse Lig1 gene (Bentley et
al., 1996
). As expected, homozygosity for the targeted
Lig1 allele resulted in embryonic lethality. However, mutant embryos
developed much further than anticipated and were indistinguishable from their
wild-type siblings up to E10.5. Only from E11.5 onwards, when the liver takes
over from the yolk sac as the major site of blood production, was a difference
observed. Mutant embryos failed to achieve normal foetal liver haematopoiesis,
leading to a severe deficiency of mature enucleated erythrocytes in the
peripheral circulation, anaemia and death by E16.5. Although the foetal livers
lacked normal erythropoietic islands, both primitive multipotent (CFU-A) and
erythroid (BFU-E) progenitors were present, but at a reduced level compared
with controls, and they also gave rise to smaller colonies in vitro. This
indicated that there was not a qualitative block on haematopoietic
differentiation but rather a quantitative impediment leading to reduced
proliferation. We therefore postulated that another ligase can compensate for
the lack of DNA ligase I in other foetal tissues but that this compensation
fails to meet the high replicative demands of foetal liver erythropoiesis.
The phenotype of our DNA ligase I knockout mice is clearly not compatible
with the report that DNA ligase I is a cell-essential gene
(Petrini et al., 1995
), and it
has been suggested (Mackenney et al.,
1997
) that we may not have completely inactivated the allele,
despite targeting having removed the 3' end of the gene and our
inability to detect either Lig1 transcripts or DNA ligase I protein
in mutant embryos. To address this issue we have now generated a second
Lig1 targeted allele. In this report we compare the phenotypes of the
two Lig1 mutant mouse lines and characterise the products from the
targeted alleles. We also investigated the particular requirement for DNA
ligase I in haematopoiesis by studying the ability of haematopoietic
precursors from mutant embryos to rescue lethally irradiated recipients.
Finally, we have isolated DNA-ligase-I-deficient fibroblasts from mutant
embryos and used them to study the role of DNA ligase I in DNA replication,
repair and the preservation of genomic stability in vitro.
| Materials and Methods |
|---|
|
|
|---|
Cells
The isolation and culture of spontaneously immortalised mouse embryonic
fibroblast lines PF20 (wild type) and PF24 (Ercc1-deficient) has been
described (Melton et al.,
1998
). The DNA-ligase-I-deficient immortalised mouse embryonic
fibroblast lines, PFL10 and PFL13, were isolated and cultured in the same way.
The source of the transformed human control cell line MRC5 (full name MRC5V1)
and the LIG1 point mutant 46BR (full name 46BR.1G1) have been
described (Somia et al.,
1993
). BrdU incorporation and detection to measure DNA replication
and flow cytometry of DNA content for cell cycle distribution were carried out
as described (McWhir et al.,
1993
). Micronuclei were detected and scored in situ in cells
growing on plastic culture dishes as described
(Melton et al., 1998
).
Assay for DNA replication intermediates
Fibroblasts, grown to 80% confluency in 30 mm dishes were rinsed twice in
warm serum-free medium and then incubated at 37°C for 10 minutes in
serum-free medium containing 4 µCi of [methyl-3H]-thymidine (25
Ci/mole). After chase times ranging from 0-30 minutes cells were scraped into
ice cold PBS, washed and resuspended in 20 µl 10mM Tris-HCl (pH 8.0), 20 mM
NaCl, 0.1 M EDTA. 60 µl of molten 1.5% low-melting point agarose was then
added to the suspension, which was mixed and left to set on ice for 5 minutes.
The DNA in the plugs was denatured, and single-stranded DNA replication
intermediates were separated on 1% agarose gels as described
(Sambrook et al., 1989
). After
electrophoresis the gels were neutralised and stained with ethidium bromide to
visualise the DNA under UV illumination. The gels were sliced into 1 cm
fractions, ranging from <0.2 to >23 kb, using size markers as a guide.
Gel fractions were transferred to scintillation vials, soaked in 0.1 M HCl for
1 hour, melted in a microwave and the [3H] present was counted in a
scintillation counter using an aqueous scintillant.
Sister chromatid exchange assay
The fluorescence plus Giemsa technique
(Perry and Wolff, 1974
) with
modifications (Goto et al.,
1978
) was used to detect SCEs. Fibroblasts were grown in medium
supplemented with 10 µM BrdU for 36-96 hours. The precise time, which
varied between lines, was sufficient for two rounds of DNA replication.
Metaphase chromosome preparations, prepared from colcemid-arrested cultures,
were immersed in Hoechst 33258, rinsed and sealed in 100 mM Na phosphate
buffer, pH 8.0. Spreads were exposed to a blacklight (18W Blacklight blue
special fluorescent lamp, peak emission 365 nm, Philips) at a distance of 5 cm
for 30 minutes at 55°C, followed by incubation in 2xSSC for 2 hours
at 65°C, rinsing in phosphate buffer pH 6.8, staining in Giemsa for 30
minutes, mounting and scoring.
Northern and western blotting
Total RNA was extracted and subjected to northern analysis as described
previously (Thompson et al.,
1989
). Protein lysates were made and subjected to western analysis
as described by Bentley et al. (Bentley et
al., 1996
). Antibodies to DNA ligases I (TL5)
(Tomkinson et al., 1990
), III
(TL25) and IV (TL18) were kindly supplied by T. Lindahl and D. Barnes (ICRF,
Clare Hall Laboratories).
Quantitative RT-PCR
RNA (20 µg) from wild type and Lig 1 null mouse cells was used
for cDNA synthesis. Samples were made up to a volume of 10 ml with sterile
distilled water, denatured at 70°C for 2 minutes, then snapcooled on ice.
Reactions were carried out at 43°C for 1 hour in 50 mM Tris-HCl, pH 8.3, 6
mM MgCl2, 40 mM KCl, 1 mM DTT supplemented with 20 units of RNasin,
dNTPs to a final concentration of 1.25 mM, 0.1 µg of random hexamers, 50 ng
oligo dT and 50 units of M-MuLV reverse transcriptase. A second round of
reverse transcription was then carried out. The mixture was heated to 70°C
for 2 minutes, snap-cooled on ice and an additional 20 units of RNasin and 50
units of reverse transcriptase added. After incubation at 43°C for a
further 1 hour, the mixture was diluted with 200 µ1 of TE and stored at
4°C. PCR reactions were then carried out as described
(Tomescu et al., 2001
) using
primers for Lig 1 exons derived from the mouse Lig 1 cDNA
sequence (Jessop and Melton,
1995
) (GenBank Acc. No. U19604): exon 4 F5284
(CTGTGTCAGACTCTGAACAGAGCTCTCC) exon 7 F5285
(GTCTTGGCACCTCTAGCAGGAGGTTTGC), 429 bp; exon 16 F5286
(CTGACCTGGATCGAATCATCCCTGTGC) exon 19 F5287
(CTTGCGCGTGGTGAGTACTTGGAATGG), 404 bp; exon 21 F8744
(GGGTGAGTTTGTCTTCACCACCTCTTTGG) exon 22 F8745
(AAGGTCTTCACCATCAGGCCCTCACAGG), 110 bp; exon 22 N2469
(CCTGTGAGGGCCTGATGGTGAAGACCTTGG) exon 23 M5176
(CCGGAATTCCGGCTTGCATATAGCCTGAAGCTCTTC), 243 bp.
The cycle conditions were: 26-28 cycles, 94°C for 1 minute, 69°C for 1 minute, 72°C for 1 minute. The quantitative nature of these PCR conditions was confirmed by using three different amounts of each cDNA, varying over a four-fold range, with scanning densitometry of the products obtained. The amounts of Lig 1 transcripts in the cell lines were standardised against a separate quantitative RT-PCR reaction for the Ercc 1 gene (mouse Ercc 1 cDNA sequence, GenBank Acc. No. X07414): exon 4 033M (CCCGTGTTGAAGTTTGTGCG) exon 6 159M (TAGCCAGCTCCTTGAGAGCC), 228 bp.
Non-quantitative (35 cycle) PCR reactions using the Lig 1 exon 21 primer in combination with a primer from the 3' end of the Hprt minigene (mouse Hprt cDNA sequence; GenBank Acc. No. J00423; exon 9 M1748, GCAGATGGCCACAGGACTAGAAC) were also used to characterise the fusion transcripts from the Lig 1 targeted alleles. After gel purification products were sequenced directly using an ABI PRISM dye terminator sequencing reaction-ready kit on an ABI PRISM 377 DNA sequencer (Perkin-Elmer Corporation). Sequence analysis was with the Genetics Computer Group programmes, version 9.
Quantitative PCR
Male donor cells were detected by a PCR reaction for the Zfy-1
gene (Kunieda et al., 1992
):
primers Zfy1 (GACTAGACATGTCTTAACATCTGTCC) and Zfy2
(CCTATTGCATGGACTGCAGCTTATG), product 0.15 kb, 20 cycles of 95°C for 1
minute, 65°C for 0.5 minutes, 72°C for 0.5 minutes. This reaction was
run in parallel with a separate reaction for the Ercc 1 gene: primers
033M (sequence already given) and 035M (CGAAGGGCGAAGTTCTTCCC), product 0.6 kb,
20 cycles of 94°C for 1 minute, 70°C for 1 minute, 72°C for 1
minute. PCR products were separated by agarose gel elecrophoresis, blotted and
hybridised to [32P]-labelled probes specific for the two products.
Levels of bound radioisotope were determined by phosphorimagery, and the ratio
of the two signals calculated. To estimate the percentage of male cells
present in a female tissue, the calculated ratios were compared against a
standard curve produced by spiking varying amounts of male cell DNA into
female cell DNA and carrying out PCR quantification in parallel to the
experimental samples.
Flow cytometry
Foetal liver cells were prepared and transplanted into
-irradiated
recipients and cell suspensions from haematopoietic tissues were prepared as
previously described (Bentley et al.,
1996
), counted electronically (Beckman Coulter) and diluted to
107 per ml in PBS. 106 cells were stained with the
desired fluorochrome-linked antibody, washed twice to remove unbound antibody
and data for 10,000 cells were acquired using a FACScan (Becton Dickinson)
with CellQuest software. The monoclonal antibodies used were obtained from
various suppliers. Caltag Ltd.: Anti-mouse IgM F(ab')2 PE-conjugated
affinity purified goat IgG, anti-mouse CD4 PE-conjugated rat monoclonal IgG2a
(clone CT-CD4), anti-mouse CD8a FITC-conjugated rat monoclonal IgG2a (clone
CT-CD8a), anti-mouse B220 PE-conjugated rat monoclonal IgG2a (clone RA3-6B2),
anti-mouse GR1 FITC-conjugated rat monoclonal IgG2a (clone RB6-8C5).
Pharmingen: Anti-mouse CD45 PE-conjugated rat monoclonal IgG2b (clone 30F
11.1), anti-mouse TCR
ß FITC-conjugated rat monoclonal IgG2b (clone
H57-797), anti-mouse Ter-119 FITC-conjugated rat monoclonal IgG2b (clone
Ter-119), anti-mouse H-2Kd FITC-conjugated rat monoclonal IgG2a (clone
SF1-1.1), anti-mouse H-2Kb PE-conjugated rat monoclonal IgG. Sigma-Aldrich
Company Ltd.: Anti-mouse CD5 FITC-conjugated rat monoclonal IgG (clone
53-7.3).
| Results |
|---|
|
|
|---|
|
|
Northern analysis on RNA extracted from primary embryonic fibroblasts cultured from Lig 1-(#53)/-(#53) embryos confirmed the lack of the normal 3.2 kb Lig 1 mRNA (Fig. 2B). However, a larger 4.1 kb transcript, produced from the new targeted allele, was evident in both Lig 1-(#12)/-(#12) and Lig 1+/-(#12) cultures. RT-PCR using primers derived from Lig 1 and Hprt exons, followed by DNA sequencing, was used to show that the transcript from the Lig 1-(#12) allele was a Lig 1/Hprt hybrid, splicing from Lig 1 exon 22 onto Hprt exon 2 and then following the normal pattern of splicing to the end of the Hprt minigene (Fig. 1). This hybrid transcript could potentially encode a fusion protein, comprising 742 residues up to the end of exon 22 of the 916 residue DNA ligase I, in frame with 209 residues from the start of Hprt exon 2 through to its normal translational stop. The predicted size of a DNA ligase I fusion protein from the Lig 1-(#12) allele would be 106 kDa.
Quantitative RT-PCR detected a Lig 1 transcript from the original Lig 1-(#53) allele where northern analysis had failed. Signals for three different Lig 1 primer pairs (exons 4-7, 16-19 and 21-22), when standardised against a reaction for exons 4-6 of the Ercc 1 gene, were <1% of the wild-type level. No signal was obtained with a Lig 1 exon 22-23 primer pair. Sequencing of the PCR product again indicated that this very rare transcript was a Lig 1/Hprt hybrid. Splicing from Lig 1 exon 22 occurred into the promoter of the Hprt minigene. A second cryptic splice occurred between the middle of Hprt exons 2 and 6 before following the normal Hprt splicing pattern to the end of the minigene. This hybrid transcript could potentially encode a fusion protein, again comprising 742 residues of DNA ligase I up to the end of exon 22, with just four additional residues from the Hprt promoter region before an in-frame stop signal. The predicted size of a DNA ligase I fusion protein from this allele would be 83 kDa.
Western blotting had previously failed to detect DNA ligase I in Lig
1-(#53)/-(#53) embryos
(Bentley et al., 1996
). This
result was confirmed and extended in Fig.
2C where no normal or altered size DNA ligase I protein could be
detected in extracts from Lig 1-(#53)/-(#53) embryos under
conditions in which wild-type DNA ligase I could be detected at 1% of the
normal concentration. DNA ligase I of normal or altered size was also not
detected in Lig 1-(#53)/-(#53) fibroblasts and Lig
1-(#12)/-(#12) embryos and primary fibroblasts (data not
shown).
Thus, embryos homozygous for the two Lig1 targeted alleles have identical phenotypes despite the very large difference in levels of transcripts encoded by the two alleles. No DNA ligase I protein could be detected from either targeted allele, and we conclude that both are effectively Lig1 null alleles. All subsequent work was carried out with animals containing the original Lig1-(#53) targeted allele, henceforth described as the Lig1- or Lig1 null allele.
Lig1 null haematopoietic cells can rescue lethally
irradiated recipients
We have previously shown that haematopoietic progenitors, which are present
in a cell suspension from single Lig1 null foetal livers, were unable
to repopulate the haematopoietic system and rescue lethally irradiated
recipients (Bentley et al.,
1996
). The presence of haematopoietic progenitors, albeit in
reduced numbers, in Lig1 null foetal liver indicated that there was
not a fundamental, qualitative haematopoietic defect associated with DNA
ligase I deficiency, but rather that the replicative impairment imposed a
quantitative defect. We investigated this further by assessing the ability of
foetal liver cell suspensions, pooled from multiple Lig1 null
embryos, to rescue lethally irradiated recipients.
E13.5 embryos were collected from matings between Lig1 heterozygotes, and anaemic Lig1 null embryos were identified. Livers were removed and stored on ice while a rapid PCR reaction was carried out on the remainder of each embryo to determine both the Lig1 genotype and sex of the embryo (using primers for the Zfy-1 gene). Foetal liver suspensions from male embryos were used for transplantation with female recipients so that the fate of the donor cells could be followed by PCR. Nine recipients were each injected with a foetal liver suspension from a single wild-type embryo. Five recipients were each injected with a foetal liver suspension pooled from three null embryos. Six irradiated control animals received no donor cells. All control animals died within two weeks. Two out of five recipients transplanted with pooled null cells survived for at least ten weeks along with two out of nine recipients of wild-type cells. Peripheral blood samples were taken from surviving animals at 4 and 6 weeks, and all animals were killed between 10 and 12 weeks for detailed analysis of haematopoietic tissues.
Animals rescued by Lig1 null cells are anaemic with
macrocytosis and reticulocytosis
Although all surviving animals were overtly healthy, with stable
bodyweights, when blood samples were taken 4 weeks after irradiation it was
found that animals rescued with Lig1 null cells were anaemic.
Haematocrits for recipients of wild-type cells were in the normal range
(42-50%), but the mean value for recipients of null cells was only 26%. The
reduced haematocrit was accompanied by macrocytosis (enlarged erythrocytes)
and reticulocytosis (increased numbers of immature erythrocytes). As the
haematocrits in animals rescued by Lig1 null cells dropped as the
experiment progressed, the proportion of reticulocytes increased. These data
indicated that a high proportion of red cells was being released prematurely
into the circulation and that the situation was deteriorating with time in
animals rescued by Lig1 null cells.
Lig1 null cells contribute to all haematopoietic tissues
Animals rescued by Lig1 null cells had enlarged spleens
(splenomegaly) compared with animals rescued by wild-type cells. This was
reflected in an increase in the number of spleen cells recovered
(Table 1). However, reduced
numbers of cells were recovered from all other haematopoietic tissues removed
from animals rescued by null as opposed to wild-type cells. This hypoplasia
was most severe in bone marrow, which has nearly five-fold fewer cells.
|
Quantitative PCR for Zfy-1 on DNA prepared from haematopoietic
tissues of rescued animals was used to estimate the contribution of
transplanted cells to each tissue (Table
1). High contributions (30-60%) of donor (male) cells were
detected in all recipient (female) tissues from animals rescued with wild-type
cells. These values are never 100% because there is always some recovery of
the lethally irradiated recipient's haematopoietic system
(Micklem et al., 1987
).
Donor-derived cells were also detected in all haematopoietic tissues from
animals rescued by Lig1 null cells but, apart from bone marrow and
spleen, the contribution of null cells to repopulated tissues was lower than
wild-type cells.
To determine whether this defect affected all haematopoietic lineages, we
analysed haematopoietic tissues from rescued mice by flow cytometry using
antibodies to: B220 (expressed on cells committed to the B lymphoid lineage);
IgM and IgD (present on mature B lymphocytes which have undergone V(D)J
recombination); CD4 and CD8 (present on thymocytes); TCR
ß (present
on thymocytes with rearrangement of the T cell receptor gene); CD5 (present on
T cells and a subset of B cells); CD45 (present on non-erythroid
haematopoietic cells); GR1 (present on granulocytes); and Ter-119 (present on
erythroid cells). The staining profiles from mice rescued with Lig1
null cells were similar to, and in many cases indistinguishable from,
wild-type controls. An accurate determination of the number of cells
expressing a particular marker(s) in a particular haematopoietic tissue was
impossible because of the low numbers of labelled cells counted but, in
general, cells of all lineages were present in reduced numbers in animals
rescued with Lig1 null cells compared with animals rescued by
wild-type cells. The one notable exception was the spleen where the number of
Ter-119-expressing (erythroid) cells was higher in the enlarged spleens from
animals rescued with Lig1 null cells. These data indicate that
Lig1 null haematopoietic stem cells can contribute to all lineages,
but in lower numbers than control cells.
Lig1 null primary mouse fibroblasts are viable but have an
elevated level of chromosome instability
To investigate the properties of DNA ligase I null cells in vitro, primary
embryonic fibroblast cultures were established from E12.5 embryos obtained
from matings between animals heterozygous for the original
Lig1- targeted allele
(Bentley et al., 1996
).
Cultures isolated from Lig1-/- embryos grew more slowly
than control cultures from Lig1+/+ embryos (generation
time
48 hours for mutant cultures compared to
36 hours for controls;
data not shown), but flow cytometry on propidiumiodide stained nuclei from
cultures (passage 2-passage 5) showed the same cell cycle distribution for
both genotypes (data not shown). Following a 2 hour pulse with BrdU, to
identify cells in S-phase, 42±5% of cells from two independent control
cultures (passage 2) showed nuclei stained with an anti-BrdU antibody. The
corresponding value for three independent mutant cultures was only slightly
lower (37±2%), confirming the similar cell cycle characteristics.
Defects in pathways involved in DNA maintenance are generally associated
with genomic instability (Hoeijmakers,
2001
). To investigate the possibility that DNA ligase I deficiency
may result in chromosome breakage and loss, we measured the frequency of
micronucleus formation in primary cultures of Lig1 null and control
embryonic fibroblasts. The mean frequency of micronuclei in six independent
wild-type cultures (ranging from passage 2-5) was 0.49±0.21%. The
corresponding frequency from six independent Lig1 null cultures was
four-fold higher, 2.00±0.79%. This difference was highly significant
(p=0.001 by Student's t test).
Both wild-type and DNA ligase I null primary cultures senesced rapidly. To
facilitate further analysis of DNA ligase I null cells, two spontaneously
immortalised lines, PFL10 and PFL13, were isolated. Although the immortalised
DNA ligase I null lines grew well in culture they were not as robust as
wild-type lines. They were more difficult to establish from frozen stocks, did
not plate well at low densities and their generation time was longer than
control cultures (PFL13
36 hours, PFL10
48 hours, compared with
24 hours for the wild-type PF20 control). DNA ligase I has been
implicated in a number of different repair reactions and, a priori, a DNA
repair deficiency would be the most likely explanation for the genome
instability in Lig1 null primary fibroblasts. Consequently we used
the immortalised cell lines to assess the sensitivity of DNA ligase I null
cells to a range of DNA damaging agents.
DNA ligase I is not essential for nucleotide excision repair
The human DNA ligase I point mutant cell line, 46BR, has been reported to
show increased sensitivity to a range of DNA damaging agents, including UV
light (Teo et al., 1983
), and
in vitro reconstitution of NER utilises purified DNA ligase I
(Aboussekhra et al., 1995
).
However, in the UV survival experiment shown in
Fig. 3A, the survival curves
for all ligase mutant and control cell lines were very similar. The human 46BR
point mutant was only marginally more sensitive than its species control
(MRC5). Similarly, the two mouse Lig1 null cell lines were only
slightly more sensitive than the mouse (PF20) control. When these curves are
compared with that of a mouse NER mutant (PF24, Ercc1-deficient)
(Melton et al., 1998
), it is
clear that DNA ligase I is not essential for NER: the D50 for PF24
was 1.5 Jm-2, whereas it was 7 Jm-2 for PFL10 and
PFL13.
|
DNA ligase I is not essential for repair of alkylation damage
DNA ligase I is involved in the long-patch form of BER, and 46BR cells have
been found to show increased sensitivity to alkylating agents
(Teo et al., 1983
). Survival
curves for EMS are shown in Fig.
3B. The 46BR point mutant was five-fold more sensitive to EMS than
MRC5 (D50 120 µM compared to 650 µM for MRC5). All the mouse
lines were more resistant to EMS than the human control, with the two null
lines (PFL10 and PFL13) indistinguishable from the PF20 control. Thus, as
predicted from the existence of alternate pathways, DNA ligase I is not
essential for repair of damage induced by alkylating agents.
Mouse DNA ligase I null cells are not hypersensitive to
3-aminobenzamide
Poly(ADP-ribose) polymerase (PARP) binds to DNA strand breaks and
facilitates DNA ligation (Satoh and
Lindahl, 1992
). 3-aminobenzamide is a specific inhibitor of PARP
that causes an accumulation of strand breaks. The reported increased
sensitivity of 46BR cells to 3-aminobenzamide
(Lehmann et al., 1988
) was
confirmed in Fig. 3C. 46BR
cells were two-fold more sensitive than MRC5 (D50 3 mM compared to
7 mM for MRC5). Although the mouse lines again showed greater resistance to
3-aminobenzamide, the Lig1 null lines (PFL10 D50 6 mM,
PFL13 4.5 mM) were 1.5-fold more sensitive than the control (PF20 8.3 mM).
DNA ligase I is not essential for repair of ionising radiation
damage
Although DNA ligase IV is the key ligase for double-strand break repair,
46BR cells have been reported to show increased sensitivity to ionising
radiation (Teo et al., 1983
).
The increased sensitivity of 46BR compared with MRC5 was confirmed in
Fig. 3D (46BR D50
5.7 Gy, MRC5 9 Gy). The two mouse Lig1 null lines were not more
sensitive than the PF20 control. The survival curve for PFL13 (D50
8.5 Gy) was very similar to PF20 (D50 9 Gy). The curve for PFL10
was shallower and reproducibly lacked a conventional shoulder, resulting in an
apparently higher D50 (15 Gy) than the wild-type control.
Replication intermediates accumulate in Lig1 null cells
In the absence of a clear DNA repair defect in Lig1 null cells, we
next investigated DNA replication as a possible explanation for the genome
instability. 40-300 base DNA replication intermediates (Okazaki fragments) are
extremely transient in wild-type cells, but can be readily detected in 46BR
cells by giving short pulses of [3H]-thymidine, then chasing with
unlabelled thymidine and measuring radioactivity in single-stranded DNA
fractions of different sizes (Henderson et
al., 1985
). The results of such an experiment for fractions
ranging from <0.2 to >23 kb are summarised in
Fig. 4. Following the pulse,
<2% of the total radioactivity incorporated into DNA in both wild-type
human (MRC5) and mouse (PF20) cells was present in DNA molecules <2.0 kb
and that which was present was rapidly chased into larger fractions. In
contrast 23% of the radioactivity in the human DNA ligase I point mutant
(46BR) was in the <2.0kb fraction after the pulse, and this did not
completely disappear during the 30 minute chase. The situation in the mouse
Lig1 null line (PFL13) was intermediate between 46BR and the
wild-type controls. 10% of the radioactivity was in the <2.0 kb fraction
after the pulse, but this disappeared completely after a 15 minute chase.
Thus, the ligation of replication intermediates is delayed in Lig1
null mouse fibroblasts, but the delay is not so pronounced as in the human
LIG1 point mutant.
|
Sister chromatid exchange rates are normal in Lig1 null
mouse fibroblasts
One of the characteristics of Bloom's syndrome is a very high level of
reciprocal interchanges between homologous chromatids (sister chromatid
exchange, SCE). 46BR cells also show an increased frequency of SCEs and are
hypersensitive to the induction of SCE by DNA damaging agents
(Henderson et al., 1985
).
Because Lig1 null fibroblasts showed increased chromosome
instability, as determined by micronucleus formation, we also measured the
spontaneous incidence of SCE in a range of primary cultures and immortalised
cell lines (Table 2). All mouse
and human wild-type samples displayed SCE rates consistent with previous
studies (
10 SCEs per metaphase) (e.g.
McDaniel and Schultz, 1992
).
As expected, the mean number of SCEs per metaphase was significantly elevated
(2.4-fold) in 46BR cells compared with the human (MRC5) control (Mann-Whitney
U test, p <0.05). However, there was no significant difference in SCE
frequency between primary (Lig1-/-) or immortalised
(PFL13) DNA Lig1 null cells compared with wild-type controls
(Lig1+/+ and PF20).
|
Levels of DNA ligases III and IV are not increased to compensate for
DNA ligase I deficiency
DNA ligase I is highly expressed in proliferating cells, but corresponding
levels of other DNA ligases are generally much lower. To investigate the
possibility that increased expression of DNA ligases III or IV might be
compensating for DNA ligase I deficiency, the levels of Lig3 and
Lig4 transcripts and proteins were determined in mid-gestation
embryos (Lig1+/+,+/-,-/-) and immortalised cell lines
(PF20, PFL10, PFL13). No differences in Lig3 and Lig4
transcripts were observed (data not shown). Ligase III and ligase IV proteins
were readily detected by the antisera used, but there was no indication that
the level of either was altered by DNA ligase I deficiency
(Fig. 5).
|
| Discussion |
|---|
|
|
|---|
The low level of mRNA from the Lig1-(#53) allele,
detectable only by RT-PCR, could be because of a low level of transcription or
the instability of the hybrid transcript. We have previously shown that
transcription from the PGK-HPRT(RI) minigene is particularly unstable at the
Lig1 locus, with the mouse Pgk promoter becoming heavily
methylated (Melton et al.,
1997
). Transcription from the mouse Hprt promoter in the
DWM110 minigene, inserted at the identical position in the
Lig1-(#12) allele, was not similarly affected. Perhaps the
silencing of the PGK-HPRT(RI) minigene extends to the Lig1 promoter
itself to result in the low level of transcripts from the
Lig1-(#53) allele.
Despite the presence of abundant transcripts from the new
Lig1-(#12) targeted allele, the phenotype of mutant
embryos was identical to the one we have previously reported for the original
Lig1-(#53) allele. This strengthens the argument that our
Lig1 targeted alleles produce no functional DNA ligase I because, if
there were residual ligase activity from the Lig1-(#53)
allele, greater activity and a milder phenotype would be expected from the
Lig1-(#12) allele with its much higher level of
Lig1 transcripts. There is additional evidence that, even if a DNA
ligase I fusion protein were produced, it would have no catalytic activity.
Removal of more than 16 amino acids from the C-terminus of human DNA ligase I
rendered the protein enzymatically inactive
(Kodama et al., 1991
). Any
fusion protein produced from our targeted alleles would lack the C-terminal
174 residues and should therefore be catalytically inactive. With the high
levels of DNA ligase I activity normally found in proliferating cells, we
consider it unlikely that an undetectable amount of a theoretical protein that
should have no activity could meet the catalytic requirements for ligase I
activity in early mouse embryos. Consequently, we feel justified in describing
our Lig1 targeted alleles as effective nulls for DNA ligase I.
DNA ligase I is not essential for mammalian cell viability
How can our results be reconciled with the report that DNA ligase I is
essential for mammalian cell viability
(Petrini et al., 1995
)? This
conclusion arose from the failure to isolate mouse embryonic stem (ES) cells
homozygous for a Lig1 targeted allele following in vitro selection
for gene conversion events in ES cells heterozygous for the targeted allele.
We consider that this failure could result instead from the inherent
difficulty of isolating ES cells homozygous for a disabling mutation under
stringent selection conditions where single Lig1 null cells may be
viable but unable to proliferate sufficiently at low cell densities to form a
colony and be detected. The fragility of our immortalised Lig1 null
fibroblasts, particularly at low plating densities, would support this
suggestion. The failure of Petrini et al. to isolate ES cells homozygous for
the Lig1 targeted allele could also be because of the targeting
strategy employed, which replaced exons 17-19 with a selectable marker.
Although any product from this targeted allele would be catalytically inactive
with the probes and antisera used, Petrini et al. did not exclude the
possibility that an altered protein was produced from their targeted allele.
We suggest that the presence of an inactive DNA-ligase-I-derived protein may
actually hamper cell survival, possibly by preventing another ligase from
acting instead of DNA ligase I (see below).
Lig1 null cells can repopulate the haematopoietic system of
lethally irradiated recipients
Lig1 null embryos die as a consequence of failure to make the
transition in erythropoiesis from yolk sac to foetal liver, despite the
presence of haematopoietic progenitors in foetal liver. This led us to propose
a model involving a quantitative, rather than a qualitative, defect in
haematopoiesis in Lig1 null embryos, which only manifested itself
under the extremely high requirement for erythropoiesis in foetal liver. One
prediction of this model that we have gone on to demonstrate is that
Lig1 null foetal liver cells, when transplanted in sufficient
quantity, should be able to repopulate the haematopoietic system and rescue
lethally irradiated recipients. Pooled Lig1 null liver suspensions
were as effective as individual wild-type liver suspensions in effecting
rescue. The progressive anaemia and elevated levels of reticulocytes in
animals rescued with Lig1-/- cells indicate that
Lig1 null haematopoietic cells are unable to meet demand for
erythrocyte production. Similarly, cell numbers in all haematopoietic tissues
from animals rescued by Lig1 null cells were reduced compared with
animals rescued by wild-type cells. However, all lineages were present in all
haematopoietic tissues examined from animals rescued by Lig1 null
cells. The enlarged spleens in animals rescued by Lig1 null cells
were consistent with the known kinetics of haematopoietic repopulation coupled
with the normal physiological response to chronic anaemia. These observations
are in keeping with the phenotype of the developing Lig1 null embryos
themselves and are consistent with a quantitative deficiency relating to
reduced proliferation rather than a qualitative block in any haematopoietic
lineage. In particular, the normal ratio of B220 to IgM and IgD expression
observed supports previous in vitro observations in 46BR cells
(Petrini et al., 1994
) that
DNA ligase I is not necessary for V(D)J recombination.
DNA ligase I is not essential for DNA repair
The human LIG1 point mutant 46BR has been reported to show
increased UV sensitivity (Teo et al.,
1983
), although we could not demonstrate this in our study. DNA
ligase I is a component of the NER reaction reconstituted in vitro
(Aboussekhra et al., 1995
), but
our UV survival experiments on Lig1 null mouse fibroblasts showed
clearly that DNA ligase I was not essential for NER. Similarly, although DNA
ligase I is involved in the long-patch form of BER
(Lindahl et al., 1997
) and
46BR cells show increased sensitivity to alkylating agents
(Teo et al., 1983
), the EMS
survival curves for our Lig1 null mouse fibroblasts were
indistinguishable from the wild-type mouse control. Thus, as perhaps could be
predicted from the involvement of DNA ligase III in the predominant
short-patch form of BER, DNA ligase I is also not essential for repair of
alkylation damage. DNA ligase IV is essential for double-strand break repair
(Timson et al., 2000
), but
46BR cells have been reported to show increased sensitivity to ionising
radiation (Teo et al., 1983
),
and DNA ligase I is active in the V(D)J recombination mechanism in vitro
(Ramsden et al., 1997
). Our
data provide no evidence for a role for DNA ligase I in double-strand break
repair. In fact, the
-irradiation survival curve for PFL10, our slowest
growing Lig1 null line, reproducibly indicated a slight increase in
survival compared with the control, although this is more likely to be as a
consequence of the slower growth rate and the resulting requirement to plate
these cells at a higher density rather than a real increase in survival.
Hence, in contrast to results from 46BR cells, we were unable to detect a
measurable NER, BER or double-strand break repair defect in Lig1 null
cells. Lig1 null cells did show a mildly increased sensitivity to
3-aminobenzamide compared with wild-type, although not to the level of 46BR
cells. 3-aminobenzamide is an inhibitor of PARP. Although its precise role
remains to be defined (for a review, see
Herceg and Wang, 2001
), PARP
binds to DNA strand breaks and is known to stimulate DNA ligase activity
(Satoh and Lindahl, 1992
).
Differences in 3-aminobenzamide sensitivity between 46BR and Lig1
null cells may reflect an underlying difference in the number of DNA strand
breaks occurring within the two cell types, correlating with observed
differences in DNA replication.
Replication intermediates accumulate in Lig1 null cells
46BR cells are defective in the joining of Okazaki fragments
(Prigent et al., 1994
), and
this was clearly evident in our pulse-chase experiment as an accumulation
after the pulse of short single-stranded DNA fragments that were slow to chase
into high molecular weight DNA. The Lig1 null cells also showed an
accumulation of replication intermediates, but the accumulation was not as
marked as in 46BR cells and the intermediates were chased away more rapidly.
This accumulation of replication intermediates in Lig1 null cultured
cells is compatible with the slower growth rate that we have observed and
could provide the basis for the failure of Lig1 null embryos when the
replicative demands of erythropoiesis are highest.
Increased genome instability in Lig1 null cells
One aim of our work with DNA ligase I is to produce a mouse model for the
46BR patient to study the relationship between DNA ligase I deficiency and
cancer susceptibility. Since genome instability plays an important role in
cancer development, we measured instability and found a four-fold higher level
in primary cultures of Lig1 null embryonic fibroblasts compared with
wild-type controls. The micronucleus assay used detects whole chromosomes or
chromosome fragments that have failed to segregate correctly at mitosis. The
increased frequency of micronuclei was not mirrored in a similar increase in
sister chromatid exchanges in Lig1 null cells.
Genome instability usually results from mutation in cell cycle control
genes, such as p53 (Levine,
1997
), or from DNA repair deficiency
(Hoeijmakers, 2001
). The
importance of NHEJ components, including DNA ligase IV, in the maintenance of
genome stability has been demonstrated
(Ferguson et al., 2000
). The
genome instability in Lig1 null cells could result directly from the
altered DNA replication, particularly since we have no evidence for any DNA
repair defect that could also contribute to the instability. As such, Lig1
null cells would represent an unusual situation where there is genome
instability in the absence of sensitivity to DNA damaging agents. A similar
explanation could apply to at least a component of the instability observed in
PARP-deficient cells (for a review, see
Herceg and Wang, 2001
).
Compensation for DNA ligase I deficiency
Another DNA ligase must be compensating for the lack of DNA ligase I in our
Lig1 null cells and embryos. We found no evidence for a compensatory
increase in expression of the two obvious candidates, DNA ligases III and IV,
but this does not exclude their involvement since both were readily detected
and so increased expression may not be a prerequisite.
Lig1 null mouse cells were less sensitive to UV, EMS and
-irradiation than human 46BR cells when compared with their species
controls. The accumulation of replication intermediates was also more
pronounced in 46BR than Lig1 null cells, and only 46BR cells showed
an elevated frequency of SCEs. This could be caused by ligase I playing
different roles in the two species. Alternatively, in many respects, it may be
better to have a complete absence of ligase I, rather than produce a partially
functional enzyme as is the case with the 46BR cell line. This is not
surprising given that interaction with PCNA has been demonstrated to be
important for DNA ligase I function in joining Okazaki fragments and in
long-patch BER (Levin et al.,
2000
). Perhaps only in the absence of DNA ligase I is another DNA
ligase able to effectively complement for the missing ligase activity. Our
results emphasise that the 46BR patient is a special case of DNA ligase I
deficiency and that the 46BR phenotype is not necessarily representative of
the effects of the complete absence of DNA ligase I. Nevertheless it must be
remembered that, as with Lig4
(Frank et al., 1998
;
Barnes et al., 1998
), the
Lig1 null mutation is embryonic lethal, and so the importance of DNA
ligase I should not be underestimated.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Aboussekhra, A., Biggerstaff, M., Shivji, M. K. K., Vilpo, J. A., Moncollin, V., Podust, V. N., Protic, M., Hubscher, U., Egly, J. M. and Wood, R. D. (1995). Mammalian DNA nucleotide excision repair reconstituted with purified protein components. Cell 80,859 -868.[Medline]
Barnes, D. E., Tomkinson, A. E., Lehmann, A. R., Webster, A. D. B. and Lindahl, T. (1992). Mutations in the DNA ligase I gene in an individual with immunodeficiencies and cellular hypersensitivity to DNA-damaging agents. Cell 69,495 -504.[Medline]
Barnes, D. E., Stamp, G., Rosewell, I., Denzel, A. and Lindahl, T. (1998). Targeted disruption of the gene encoding DNA ligase IV leads to lethality in embryonic mice. Curr. Biol. 8,1395 -1398.[Medline]
Bentley, D. J., Selfridge, J., Millar, J. K., Samuel, K., Hole, N., Ansell, J. D. and Melton, D. W. (1996). DNA ligase I is required for foetal liver erythropoiesis but is not essential for mammalian cell viability. Nat. Genet. 13,489 -491.[Medline]
Cappelli, E., Taylor, R., Cevasco, M., Abbondandolo, A.,
Caldecott, K. and Frosina, G. (1997). Involvement of XRCC1
and DNA ligase III gene products in DNA base excision repair. J.
Biol. Chem. 272,23970
-23975.
Ellis, N. A., Groden, J., Ye, T.-E., Straughen, J., Lennon, D. J., Ciocci, S., Proytcheva, M. and German, J. (1995). The Bloom's syndrome gene product is homologous to RecQ helicases. Cell 83,655 -666.[Medline]
Ferguson, D. O., Sekiguchi, J. M., Chang, S., Frank, K. M., Gao,
Y., DePinho, R. A. and Alt, F. W. (2000). The nonhomologous
end-joining pathway of DNA repair is required for genomic stability and the
suppression of translocations. Proc. Natl. Acad. Sci.
USA 97,6630
-6633.
Frank, K. M., Sekiguchi, J. M., Seidl, K. J., Swat, W., Rathbun, G. A., Cheng, H. L., Davidson, L., Kangaloo, L. and Alt, F. W. (1998). Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV. Nature 396,173 -177.[Medline]
German, J. (1993). Bloom Syndrome: A mendelian prototype of somatic mutational disease. Medicine 72,393 -406.[Medline]
Goto, K., Maeda, S., Kano, Y. and Sugiyama, T. (1978). Factors involved in differential Giemsa-staining of sister chromatids. Chromosoma 66,351 -359.[Medline]
Grawunder, U., Zimmer, D., Fugmann, S., Schwarz, K. and Lieber, M. R. (1998). DNA ligase IV is essential for V(D)J recombination and DNA double-strand break repair in human precursor lymphocytes. Mol. Cell 2, 477-484.[Medline]
Henderson, L. M., Arlett, C. F., Harcourt, S. A., Lehmann, A. R.
and Broughton, B. C. (1985). Cells from an immunodeficient
patient (46BR) with a defect in DNA ligation are hypomutable but
hypersensitive to the induction of sister chromatid exchanges.
Proc. Natl. Acad. Sci. USA
82,2044
-2048.
Herceg, Z. and Wang, Z.-Q. (2001). Functions of poly(ADP-ribose) polymerase (PARP) in DNA repair, genomic integrity and cell death. Mutat. Res. 477,97 -110.[Medline]
Hoeijmakers, J. H. J. (2001). Genome maintenance mechanisms for preventing cancer. Nature 411,366 -374.[Medline]
Jessop, J. K. and Melton, D. W. (1995). Comparison between cDNA clones encoding murine DNA ligase I. Gene 160,307 -308.[Medline]
Kodama, K.-I., Barnes, D. E. and Lindahl, T.
(1991). In vitro mutagenesis and functional expression
in Escherichia coli of a cDNA encoding the catalytic domain of human
DNA ligase I. Nucleic Acids Res.
19,6093
-6099.
Kunieda, T., Xian, M. W., Kobayashi, E., Imamichi, T., Moriwaki, K. and Toyoda, Y. (1992). Sexing of mouse preimplantation embryos by detection of Y-chromosome-specific sequences using polymerase chain reaction. Biol. Reprod. 46,692 -697.[Abstract]
Lehmann, A. R., Willis, A. E., Broughton, B. C., James, M. R., Steingrimsdottir, H., Harcourt, S. A., Arlett, C. F. and Lindahl, T. (1988). Relation between the human fibroblast strain 46BR and cell lines representative of Bloom's syndrome. Cancer Res. 48,6353 -6357.
Levin, D. S., McKenna, A. E., Motycka, T. A., Matsumoto, Y. and Tomkinson, A. E. (2000). Interaction between PCNA and DNA ligase I is critical for joining of Okazaki fragments and long-patch base-excision repair. Curr. Biol. 10,919 -922.[Medline]
Levine, A. J. (1997). p53, the cellular gatekeeper for growth and division. Cell 88,323 -331.[Medline]
Lindahl, T., Karran, P. and Wood, R. D. (1997). DNA excision repair pathways. Curr. Opin. Genet. Dev. 7, 158-169.[Medline]
Mackenney, V. J., Barnes, D. E. and Lindahl, T.
(1997). Specific function of DNA ligase I in simian virus 40 DNA
replication by human cell-free extracts is mediated by the amino-terminal
non-catalytic domain. J. Biol. Chem.
272,11550
-11556.
Magin, T. M., McWhir, J. and Melton, D. W.
(1992). A new mouse embryonic stem cell line with good germline
contribution and gene targeting frequency. Nucleic Acids
Res. 20,3795
-3796.
McDaniel, L. D. and Schultz, R. A. (1992).
Elevated sister chromatid exchange phenotype of Bloom syndrome cells is
complemented by human chromosome 15. Proc. Natl. Acad. Sci.
USA 89,7968
-7972.
McWhir, J., Selfridge, J., Harrison, D. J., Squires, S. and Melton, D. W. (1993). Mice with DNA repair gene (ERCC-1) deficiency have elevated levels of p53, liver nuclear abnormalities and die before weaning. Nat. Genet. 5, 217-224.[Medline]
Melton, D. W., Ketchen, A.-M. and Selfridge, J.
(1997). Stability of Hprt marker gene expression at
different gene-targeted loci: observing and overcoming a position effect.
Nucleic Acids Res. 25,3937
-3943.
Melton, D. W., Ketchen, A.-M., Nuñez, F., Bonatti-Abbondandolo, S., Abbondandolo, A., Squires, S. and Johnson, R. T. (1998). Cells from Erccl-deficient mice show increased genome instability and a reduced frequency of S-phase-dependent illegitimate chromosome exchange, but a normal frequency of homologous recombination. J. Cell Sci. 111,395 -404.[Abstract]
Micklem, H. S., Lennon, J. E., Ansell, J. D. and Gray, R. A. (1987). Numbers and dispersion of repopulating haematopoietic cell clones in radiation chimeras as functions of injected cell dose. Exp. Hematol. 15,251 -257.[Medline]
Perry, P. and Wolff, S. (1974). New Geimsa method for the differential staining of sister chromatids. Nature 251,156 -158.[Medline]
Petrini, J. H. H., Donovan, J. W., Dimare, C. and Weaver, D. T. (1994). Normal V(D)J coding junction formation in DNA ligase I deficiency syndrome. J. Immunol. 152,176 -183.[Abstract]
Petrini, J. H. J., Xiao, Y. H. and Weaver, D. T. (1995). DNA ligase-I mediates essential functions in mammalian cells. Mol. Cell. Biol. 15,4303 -4308.[Abstract]
Prigent, C., Satoh, M. S., Daly, G., Barnes, D. E. and Lindahl,
T. (1994). Aberrant DNA repair and DNA replication due to an
inherited enzymatic defect in human DNA ligase I. Mol. Cell.
Biol. 14,310
-317.
Ramsden, D. A., Paull, T. T. and Gellert, M. (1997). Cell-free V(D)J recombination. Nature 388,488 -491.[Medline]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (eds) (1989). Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, New York.
Satoh, M. S. and Lindahl, T. (1992). Role of poly(ADP-ribose) formation in DNA repair. Nature 356,356 -358.[Medline]
Shivji, M. K. K., Podust, V. N., Hubscher, U. and Wood, R. D. (1995). Nucleotide excision repair DNA synthesis by DNA polymerase epsilon in the presence of PCNA, RFC, and RPA. Biochem. 35,5011 -5017.
Somia, N. V., Jessop, J. K. and Melton, D. W. (1993). Phenotypic correction of a human cell line (46 BR) with aberrant DNA ligase I activity. Mutat. Res. 294, 51-58.[Medline]
Teo, I. A., Arlett, C. F., Harcourt, S. A., Priestley, A. and Broughton, B. C. (1983). Multiple hypersensitivity to mutagens in a cell strain (46BR) derived from a patient with immuno-deficiencies. Mutat. Res. 107,371 -386.[Medline]
Thompson, S., Clarke, A. R., Pow, A. M., Hooper, M. L. and Melton, D. W. (1989). Germ line transmission of a corrected Hprt gene produced by gene targeting in embryonic stem cells. Cell 56,313 -321.[Medline]
Timson, D. J., Singleton, M. R. and Wigley, D. B. (2000). DNA ligases in the repair and replication of DNA. Mutat. Res. 460,301 -318.[Medline]
Tom, S., Henricksen, L. A., Park, M. S. and Bambara, R. A.
(2001). DNA ligase I and proliferating cell nuclear antigen form
a functional complex. J. Biol. Chem.
276,24817
-24825.
Tomescu, D., Ha, T., Kavanagh, G., Campbell, H. and Melton, D.
W. (2001). Nucleotide excision repair gene XPD polymorphisms
and predisposition to melanoma. Carcinogenesis
22,403
-408.
Tomkinson, A. E., Lasko, D. D., Daly, G. and Lindahl, T.
(1990). Mammalian DNA ligases. Catalytic domain and size of DNA
ligase I. J. Biol. Chem.
265,12611
-12617.
Waga, S., Bauer, G. and Stillman, B. (1994).
Reconstitution of complete SV40 DNA replication with purified replication
factors. J. Biol. Chem.
269,10923
-10935.
Webster, A. D. B., Barnes, D. E., Arlett, C. F., Lehmann, A. R. and Lindahl, T. (1992). Growth retardation and immunodeficiency in a patient with mutations in the DNA ligase I gene. Lancet 339,1508 -1509.[Medline]
This article has been cited by other articles:
![]() |
J. Kenyon and S. L. Gerson The role of DNA damage repair in aging of adult stem cells Nucleic Acids Res., December 26, 2007; (2007) gkm1064v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Muylaert and P. Elias Knockdown of DNA Ligase IV/XRCC4 by RNA Interference Inhibits Herpes Simplex Virus Type I DNA Replication J. Biol. Chem., April 13, 2007; 282(15): 10865 - 10872. [Abstract] [Full Text] [PDF] |
||||
![]() |
|