spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bentley, D. J.
Right arrow Articles by Melton, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bentley, D. J.
Right arrow Articles by Melton, D. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Cell Science 115, 1551-1561 (2002)
© 2002 The Company of Biologists Limited


Research Article

DNA ligase I null mouse cells show normal DNA repair activity but altered DNA replication and reduced genome stability

Darren J. Bentley1, Caroline Harrison2, Ann-Marie Ketchen2, Nicola J. Redhead2, Kay Samuel3, Martin Waterfall4, John D. Ansell4 and David W. Melton2,*

1 Institute of Cell and Molecular Biology, University of Edinburgh, Edinburgh EH9 3JR, UK
2 Sir Alastair Currie CRC Laboratories, Molecular Medicine Centre, University of Edinburgh, Edinburgh EH4 2XU, UK
3 Cell Therapy Group, Scottish National Blood Transfusion Service, Edinburgh EH4 2XU, UK
4 John Hughes Bennett Laboratory, Department of Oncology, University of Edinburgh, Edinburgh EH4 2XU, UK

* Author for correspondence (e-mail: David.Melton{at}ed.ac.uk

Accepted 6 January 2002


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DNA ligase I is the key ligase for DNA replication in mammalian cells and has also been reported to be involved in a number of recombination and repair processes. Our previous finding that Lig1 knockout mouse embryos developed normally to mid-term before succumbing to a specific haematopoietic defect was difficult to reconcile with a report that DNA ligase I is essential for the viability of cultured mammalian cells. To address this issue, we generated a second Lig1 targeted allele and found that the phenotypes of our two Lig1 mutant mouse lines are identical. Widely different levels of Lig1 fusion transcripts were detected from the two targeted alleles, but we could not detect any DNA ligase I protein, and we believe both are effective Lig1 null alleles. Using foetal liver cells to repopulate the haematopoietic system of lethally irradiated adult mice, we demonstrate that the haematopoietic defect in DNA-ligase-I-deficient embryos is a quantitative deficiency relating to reduced proliferation rather than a qualitative block in any haematopoietic lineage. DNA ligase I null fibroblasts from Lig1 mutant embryos showed an accumulation of DNA replication intermediates and increased genome instability. In the absence of a demonstrable deficiency in DNA repair we postulate that, unusually, genome instability may result directly from the DNA replication defect. Lig1 null mouse cells performed better in the survival and replication assays than a human LIG1 point mutant, and we suggest that the complete absence of DNA ligase I may make it easier for another ligase to compensate for DNA ligase I deficiency.

Key words: DNA ligases, DNA repair, DNA replication, Genome instability


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The requirement for DNA ligase activity is common to all pathways in mammalian cells by which DNA is replicated or rearranged or genomic integrity is maintained. Three distinct DNA ligase genes have been identified in humans (LIG1, LIG3 and LIG4). However, the division of roles between the encoded proteins has not yet been completely defined. Formerly it had been suggested that DNA ligase I is involved in a number of DNA replication, recombination and repair processes, but recent evidence has led to a re-evaluation of the role of this protein (for a review, see Timson et al., 2000Go).

Inherited human disorders that result in chromosome instability and cancer predisposition have been central to the understanding of many mammalian DNA metabolism and repair pathways. The paradigm for genome instability disorders is Bloom's syndrome (BS). Patients with BS have growth retardation, immune deficiency and are predisposed to a range of cancers, and cells from BS patients show a very high level of sister chromatid exchange, increased mutation and somatic recombination rate and increased sensitivity to a range of DNA damaging agents (German, 1993Go). Although BS is caused by mutations in the BLM helicase gene (Ellis et al., 1995Go), mutations in LIG1 were identified in a patient with similar physical retardation, immune deficiency and hypersensitivity to sunlight to patients with BS (Webster et al., 1992Go). A Glu566 to Lys mutation at the enzyme active site inactivated one allele, whereas an Arg771 to Trp mutation on the second allele resulted in 20-fold reduction in enzyme activity (Barnes et al., 1992Go). A fibroblast cell line isolated from this patient (46BR) showed increased sensitivity to a wide variety of DNA damaging agents, delayed joining of DNA replication intermediates and increased somatic recombination, although not to the level seen in BS (Teo et al., 1983Go; Lehmann et al., 1988Go; Prigent et al., 1994Go; Henderson et al., 1985Go). As a consequence, it was speculated that DNA ligase I plays roles in multiple DNA replication, recombination and repair pathways.

There is a wealth of evidence confirming that DNA ligase I is the main ligase involved in joining DNA replication intermediates. DNA ligase I expression and activity correlate closely with the rate of cell proliferation; the protein localises to multiprotein replication complexes and interacts with proliferating cell nuclear antigen (PCNA) (e.g. Levin et al., 2000Go; Tom et al., 2001Go) and functions in lagging-strand DNA replication in vitro (Waga et al., 1994Go). Perhaps unsurprisingly, DNA ligase I has been reported to be an essential gene for mammalian cells growing in vitro (Petrini et al., 1995Go). There is also strong evidence supporting the role of DNA ligase I in the long-patch form of base excision repair (BER) (for a review, see Lindahl et al., 1997Go), and it has also been implicated in nucleotide excision repair (NER) by in vitro reconstitution (Shivji et al., 1995Go; Aboussekhra et al., 1995Go). However, DNA ligase I is not the only DNA ligase that functions in BER. The ubiquitously expressed form of DNA ligase III (IIIa) complexes with the single-strand break repair protein, XRCC1, and is involved in the predominant (short-patch) form of BER (Cappelli et al., 1997Go). Similarly, although DNA ligase I is active in a cell-free V(D)J recombination system (Ramsden et al., 1997Go), it cannot carry out doublestrand break repair in ligase IV-defective cells (Grawunder et al., 1998Go). Instead, cultured cells lacking DNA ligase IV are both defective in V(D)J recombination and hypersensitive to ionising radiation (Frank et al., 1998Go). Hence there is uncertainty about the roles of DNA ligase I in recombination and repair and the level of redundancy with other DNA ligases.

To study the function of DNA ligase I in mammalian cells, and as the first stage in the production of a mouse model for the 46BR patient, we knocked out the mouse Lig1 gene (Bentley et al., 1996Go). As expected, homozygosity for the targeted Lig1 allele resulted in embryonic lethality. However, mutant embryos developed much further than anticipated and were indistinguishable from their wild-type siblings up to E10.5. Only from E11.5 onwards, when the liver takes over from the yolk sac as the major site of blood production, was a difference observed. Mutant embryos failed to achieve normal foetal liver haematopoiesis, leading to a severe deficiency of mature enucleated erythrocytes in the peripheral circulation, anaemia and death by E16.5. Although the foetal livers lacked normal erythropoietic islands, both primitive multipotent (CFU-A) and erythroid (BFU-E) progenitors were present, but at a reduced level compared with controls, and they also gave rise to smaller colonies in vitro. This indicated that there was not a qualitative block on haematopoietic differentiation but rather a quantitative impediment leading to reduced proliferation. We therefore postulated that another ligase can compensate for the lack of DNA ligase I in other foetal tissues but that this compensation fails to meet the high replicative demands of foetal liver erythropoiesis.

The phenotype of our DNA ligase I knockout mice is clearly not compatible with the report that DNA ligase I is a cell-essential gene (Petrini et al., 1995Go), and it has been suggested (Mackenney et al., 1997Go) that we may not have completely inactivated the allele, despite targeting having removed the 3' end of the gene and our inability to detect either Lig1 transcripts or DNA ligase I protein in mutant embryos. To address this issue we have now generated a second Lig1 targeted allele. In this report we compare the phenotypes of the two Lig1 mutant mouse lines and characterise the products from the targeted alleles. We also investigated the particular requirement for DNA ligase I in haematopoiesis by studying the ability of haematopoietic precursors from mutant embryos to rescue lethally irradiated recipients. Finally, we have isolated DNA-ligase-I-deficient fibroblasts from mutant embryos and used them to study the role of DNA ligase I in DNA replication, repair and the preservation of genomic stability in vitro.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice
The production of mice containing the original (Lig1-(#53)) null allele has been described previously (Bentley et al., 1996Go). Mice containing a new (Lig1-(#12)) null allele were generated in exactly the same way except that the gene targeting vector used contained the Hprt minigene, DWM110 (Magin et al., 1992Go), instead of PGK-HPRT (RI).

Cells
The isolation and culture of spontaneously immortalised mouse embryonic fibroblast lines PF20 (wild type) and PF24 (Ercc1-deficient) has been described (Melton et al., 1998Go). The DNA-ligase-I-deficient immortalised mouse embryonic fibroblast lines, PFL10 and PFL13, were isolated and cultured in the same way. The source of the transformed human control cell line MRC5 (full name MRC5V1) and the LIG1 point mutant 46BR (full name 46BR.1G1) have been described (Somia et al., 1993Go). BrdU incorporation and detection to measure DNA replication and flow cytometry of DNA content for cell cycle distribution were carried out as described (McWhir et al., 1993Go). Micronuclei were detected and scored in situ in cells growing on plastic culture dishes as described (Melton et al., 1998Go).

Assay for DNA replication intermediates
Fibroblasts, grown to 80% confluency in 30 mm dishes were rinsed twice in warm serum-free medium and then incubated at 37°C for 10 minutes in serum-free medium containing 4 µCi of [methyl-3H]-thymidine (25 Ci/mole). After chase times ranging from 0-30 minutes cells were scraped into ice cold PBS, washed and resuspended in 20 µl 10mM Tris-HCl (pH 8.0), 20 mM NaCl, 0.1 M EDTA. 60 µl of molten 1.5% low-melting point agarose was then added to the suspension, which was mixed and left to set on ice for 5 minutes. The DNA in the plugs was denatured, and single-stranded DNA replication intermediates were separated on 1% agarose gels as described (Sambrook et al., 1989Go). After electrophoresis the gels were neutralised and stained with ethidium bromide to visualise the DNA under UV illumination. The gels were sliced into 1 cm fractions, ranging from <0.2 to >23 kb, using size markers as a guide. Gel fractions were transferred to scintillation vials, soaked in 0.1 M HCl for 1 hour, melted in a microwave and the [3H] present was counted in a scintillation counter using an aqueous scintillant.

Sister chromatid exchange assay
The fluorescence plus Giemsa technique (Perry and Wolff, 1974Go) with modifications (Goto et al., 1978Go) was used to detect SCEs. Fibroblasts were grown in medium supplemented with 10 µM BrdU for 36-96 hours. The precise time, which varied between lines, was sufficient for two rounds of DNA replication. Metaphase chromosome preparations, prepared from colcemid-arrested cultures, were immersed in Hoechst 33258, rinsed and sealed in 100 mM Na phosphate buffer, pH 8.0. Spreads were exposed to a blacklight (18W Blacklight blue special fluorescent lamp, peak emission 365 nm, Philips) at a distance of 5 cm for 30 minutes at 55°C, followed by incubation in 2xSSC for 2 hours at 65°C, rinsing in phosphate buffer pH 6.8, staining in Giemsa for 30 minutes, mounting and scoring.

Northern and western blotting
Total RNA was extracted and subjected to northern analysis as described previously (Thompson et al., 1989Go). Protein lysates were made and subjected to western analysis as described by Bentley et al. (Bentley et al., 1996Go). Antibodies to DNA ligases I (TL5) (Tomkinson et al., 1990Go), III (TL25) and IV (TL18) were kindly supplied by T. Lindahl and D. Barnes (ICRF, Clare Hall Laboratories).

Quantitative RT-PCR
RNA (20 µg) from wild type and Lig 1 null mouse cells was used for cDNA synthesis. Samples were made up to a volume of 10 ml with sterile distilled water, denatured at 70°C for 2 minutes, then snapcooled on ice. Reactions were carried out at 43°C for 1 hour in 50 mM Tris-HCl, pH 8.3, 6 mM MgCl2, 40 mM KCl, 1 mM DTT supplemented with 20 units of RNasin, dNTPs to a final concentration of 1.25 mM, 0.1 µg of random hexamers, 50 ng oligo dT and 50 units of M-MuLV reverse transcriptase. A second round of reverse transcription was then carried out. The mixture was heated to 70°C for 2 minutes, snap-cooled on ice and an additional 20 units of RNasin and 50 units of reverse transcriptase added. After incubation at 43°C for a further 1 hour, the mixture was diluted with 200 µ1 of TE and stored at 4°C. PCR reactions were then carried out as described (Tomescu et al., 2001Go) using primers for Lig 1 exons derived from the mouse Lig 1 cDNA sequence (Jessop and Melton, 1995Go) (GenBank Acc. No. U19604): exon 4 F5284 (CTGTGTCAGACTCTGAACAGAGCTCTCC) — exon 7 F5285 (GTCTTGGCACCTCTAGCAGGAGGTTTGC), 429 bp; exon 16 F5286 (CTGACCTGGATCGAATCATCCCTGTGC) — exon 19 F5287 (CTTGCGCGTGGTGAGTACTTGGAATGG), 404 bp; exon 21 F8744 (GGGTGAGTTTGTCTTCACCACCTCTTTGG) — exon 22 F8745 (AAGGTCTTCACCATCAGGCCCTCACAGG), 110 bp; exon 22 N2469 (CCTGTGAGGGCCTGATGGTGAAGACCTTGG) — exon 23 M5176 (CCGGAATTCCGGCTTGCATATAGCCTGAAGCTCTTC), 243 bp.

The cycle conditions were: 26-28 cycles, 94°C for 1 minute, 69°C for 1 minute, 72°C for 1 minute. The quantitative nature of these PCR conditions was confirmed by using three different amounts of each cDNA, varying over a four-fold range, with scanning densitometry of the products obtained. The amounts of Lig 1 transcripts in the cell lines were standardised against a separate quantitative RT-PCR reaction for the Ercc 1 gene (mouse Ercc 1 cDNA sequence, GenBank Acc. No. X07414): exon 4 033M (CCCGTGTTGAAGTTTGTGCG) — exon 6 159M (TAGCCAGCTCCTTGAGAGCC), 228 bp.

Non-quantitative (35 cycle) PCR reactions using the Lig 1 exon 21 primer in combination with a primer from the 3' end of the Hprt minigene (mouse Hprt cDNA sequence; GenBank Acc. No. J00423; exon 9 M1748, GCAGATGGCCACAGGACTAGAAC) were also used to characterise the fusion transcripts from the Lig 1 targeted alleles. After gel purification products were sequenced directly using an ABI PRISM dye terminator sequencing reaction-ready kit on an ABI PRISM 377 DNA sequencer (Perkin-Elmer Corporation). Sequence analysis was with the Genetics Computer Group programmes, version 9.

Quantitative PCR
Male donor cells were detected by a PCR reaction for the Zfy-1 gene (Kunieda et al., 1992Go): primers Zfy1 (GACTAGACATGTCTTAACATCTGTCC) and Zfy2 (CCTATTGCATGGACTGCAGCTTATG), product 0.15 kb, 20 cycles of 95°C for 1 minute, 65°C for 0.5 minutes, 72°C for 0.5 minutes. This reaction was run in parallel with a separate reaction for the Ercc 1 gene: primers 033M (sequence already given) and 035M (CGAAGGGCGAAGTTCTTCCC), product 0.6 kb, 20 cycles of 94°C for 1 minute, 70°C for 1 minute, 72°C for 1 minute. PCR products were separated by agarose gel elecrophoresis, blotted and hybridised to [32P]-labelled probes specific for the two products. Levels of bound radioisotope were determined by phosphorimagery, and the ratio of the two signals calculated. To estimate the percentage of male cells present in a female tissue, the calculated ratios were compared against a standard curve produced by spiking varying amounts of male cell DNA into female cell DNA and carrying out PCR quantification in parallel to the experimental samples.

Flow cytometry
Foetal liver cells were prepared and transplanted into {gamma}-irradiated recipients and cell suspensions from haematopoietic tissues were prepared as previously described (Bentley et al., 1996Go), counted electronically (Beckman Coulter) and diluted to 107 per ml in PBS. 106 cells were stained with the desired fluorochrome-linked antibody, washed twice to remove unbound antibody and data for 10,000 cells were acquired using a FACScan (Becton Dickinson) with CellQuest software. The monoclonal antibodies used were obtained from various suppliers. Caltag Ltd.: Anti-mouse IgM F(ab')2 PE-conjugated affinity purified goat IgG, anti-mouse CD4 PE-conjugated rat monoclonal IgG2a (clone CT-CD4), anti-mouse CD8a FITC-conjugated rat monoclonal IgG2a (clone CT-CD8a), anti-mouse B220 PE-conjugated rat monoclonal IgG2a (clone RA3-6B2), anti-mouse GR1 FITC-conjugated rat monoclonal IgG2a (clone RB6-8C5). Pharmingen: Anti-mouse CD45 PE-conjugated rat monoclonal IgG2b (clone 30F 11.1), anti-mouse TCR{alpha}ß FITC-conjugated rat monoclonal IgG2b (clone H57-797), anti-mouse Ter-119 FITC-conjugated rat monoclonal IgG2b (clone Ter-119), anti-mouse H-2Kd FITC-conjugated rat monoclonal IgG2a (clone SF1-1.1), anti-mouse H-2Kb PE-conjugated rat monoclonal IgG. Sigma-Aldrich Company Ltd.: Anti-mouse CD5 FITC-conjugated rat monoclonal IgG (clone 53-7.3).


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lig 1 gene targeting produces mice with no detectable DNA ligase I
The structure of our original and new Lig 1 targeted alleles is shown schematically in Fig. 1. In both cases the 3' end of the Lig 1 gene (exons 23-27), encoding 174 residues of the 916 amino acid protein, has been deleted and replaced with an Hprt minigene: PGK-HPRT(RI) in the case of the original targeted allele (Lig 1-(#53)) and the more highly expressed DWM110 in the case of the new allele (Lig 1-(#12)). Embryos homozygous for the new Lig 1-(#12) allele had a phenotype identical to one that we have previously reported for embryos homozygous for the original Lig 1-(#53) allele: embryos were indistinguishable from wild-type controls up until E10.5 but then became progressively more anaemic, failing to make the transition in erythropoiesis from yolk sac to foetal liver and dying at E15.5/16.5 (Fig. 2A).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. Structure and expression of Lig 1 targeted alleles. The structure of the 3' end of the wild-type and Lig 1 targeted alleles is shown schematically. Lig 1 exons are depicted as numbered open boxes. In the Lig 1-(#53) allele, exons 23-27 have been replaced by the PGK-HPRT(RI) Hprt minigene. Hprt exons are shown as numbered closed boxes with the Pgk promoter cross-hatched. In the Lig 1-(#12) allele, exons 23-27 have been replaced by the DWM110 Hprt minigene, with the Hprt promoter stippled. The normal RNA splicing pattern for Lig 1 mRNA is indicated and the sequences present in the Lig 1/Hprt fusion transcripts from the Lig 1 targeted alleles are shown. Note that the fusion transcript from the Lig 1-(#53) allele is rare.

 


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 2. Phenotype of Lig 1 gene targeted mice and expression from the targeted alleles. (A) Morphology of wild-type (left) and Lig 1-(#12)/-(#12) (right) embryos at E16.5. Note that the mutant embryos are smaller, anaemic and lack the erythropoiesis clearly evident in the wild-type foetal liver (*). (B) Northern analysis of Lig 1 transcripts. RNA (30 µg) extracted from primary embryonic fibroblasts (wild-type, heterozygous and homozygous for the Lig 1-(#12) and Lig 1-(#53) targeted alleles) was probed with a 2.1 kb fragment of mouse Lig 1 cDNA (Bentley et al., 1996Go). The position of the 3.2 kb wild-type Lig 1 mRNA is indicated. Note the larger (4.1 kb) transcript from the Lig 1-(#12) allele, whereas a transcript is undetectable from the original Lig 1-(#53) allele by northern analysis. Equivalent RNA loadings were confirmed by ethidium bromide staining of the gel prior to transfer. (C) Western analysis of DNA ligase I in wild-type and homozygous Lig 1-(#53) mutant embryos. Protein extracted from E13.5 embryos was probed with the TL5 rabbit polyclonal antibody raised against purified bovine DNA ligase I. This antibody predominantly recognises epitopes in the N-terminus of the protein. 100 µg of protein was loaded in each lane, but in addition to pure wild-type and mutant extracts, mutant extracts were also spiked with the percentages indicated of the wild-type sample. The position of the 102 kDa wild-type DNA ligase I protein is indicated by the arrow. The mobility of Mr markers (kDa) on the same gel is shown.

 

Northern analysis on RNA extracted from primary embryonic fibroblasts cultured from Lig 1-(#53)/-(#53) embryos confirmed the lack of the normal 3.2 kb Lig 1 mRNA (Fig. 2B). However, a larger 4.1 kb transcript, produced from the new targeted allele, was evident in both Lig 1-(#12)/-(#12) and Lig 1+/-(#12) cultures. RT-PCR using primers derived from Lig 1 and Hprt exons, followed by DNA sequencing, was used to show that the transcript from the Lig 1-(#12) allele was a Lig 1/Hprt hybrid, splicing from Lig 1 exon 22 onto Hprt exon 2 and then following the normal pattern of splicing to the end of the Hprt minigene (Fig. 1). This hybrid transcript could potentially encode a fusion protein, comprising 742 residues up to the end of exon 22 of the 916 residue DNA ligase I, in frame with 209 residues from the start of Hprt exon 2 through to its normal translational stop. The predicted size of a DNA ligase I fusion protein from the Lig 1-(#12) allele would be 106 kDa.

Quantitative RT-PCR detected a Lig 1 transcript from the original Lig 1-(#53) allele where northern analysis had failed. Signals for three different Lig 1 primer pairs (exons 4-7, 16-19 and 21-22), when standardised against a reaction for exons 4-6 of the Ercc 1 gene, were <1% of the wild-type level. No signal was obtained with a Lig 1 exon 22-23 primer pair. Sequencing of the PCR product again indicated that this very rare transcript was a Lig 1/Hprt hybrid. Splicing from Lig 1 exon 22 occurred into the promoter of the Hprt minigene. A second cryptic splice occurred between the middle of Hprt exons 2 and 6 before following the normal Hprt splicing pattern to the end of the minigene. This hybrid transcript could potentially encode a fusion protein, again comprising 742 residues of DNA ligase I up to the end of exon 22, with just four additional residues from the Hprt promoter region before an in-frame stop signal. The predicted size of a DNA ligase I fusion protein from this allele would be 83 kDa.

Western blotting had previously failed to detect DNA ligase I in Lig 1-(#53)/-(#53) embryos (Bentley et al., 1996Go). This result was confirmed and extended in Fig. 2C where no normal or altered size DNA ligase I protein could be detected in extracts from Lig 1-(#53)/-(#53) embryos under conditions in which wild-type DNA ligase I could be detected at 1% of the normal concentration. DNA ligase I of normal or altered size was also not detected in Lig 1-(#53)/-(#53) fibroblasts and Lig 1-(#12)/-(#12) embryos and primary fibroblasts (data not shown).

Thus, embryos homozygous for the two Lig1 targeted alleles have identical phenotypes despite the very large difference in levels of transcripts encoded by the two alleles. No DNA ligase I protein could be detected from either targeted allele, and we conclude that both are effectively Lig1 null alleles. All subsequent work was carried out with animals containing the original Lig1-(#53) targeted allele, henceforth described as the Lig1- or Lig1 null allele.

Lig1 null haematopoietic cells can rescue lethally irradiated recipients
We have previously shown that haematopoietic progenitors, which are present in a cell suspension from single Lig1 null foetal livers, were unable to repopulate the haematopoietic system and rescue lethally irradiated recipients (Bentley et al., 1996Go). The presence of haematopoietic progenitors, albeit in reduced numbers, in Lig1 null foetal liver indicated that there was not a fundamental, qualitative haematopoietic defect associated with DNA ligase I deficiency, but rather that the replicative impairment imposed a quantitative defect. We investigated this further by assessing the ability of foetal liver cell suspensions, pooled from multiple Lig1 null embryos, to rescue lethally irradiated recipients.

E13.5 embryos were collected from matings between Lig1 heterozygotes, and anaemic Lig1 null embryos were identified. Livers were removed and stored on ice while a rapid PCR reaction was carried out on the remainder of each embryo to determine both the Lig1 genotype and sex of the embryo (using primers for the Zfy-1 gene). Foetal liver suspensions from male embryos were used for transplantation with female recipients so that the fate of the donor cells could be followed by PCR. Nine recipients were each injected with a foetal liver suspension from a single wild-type embryo. Five recipients were each injected with a foetal liver suspension pooled from three null embryos. Six irradiated control animals received no donor cells. All control animals died within two weeks. Two out of five recipients transplanted with pooled null cells survived for at least ten weeks along with two out of nine recipients of wild-type cells. Peripheral blood samples were taken from surviving animals at 4 and 6 weeks, and all animals were killed between 10 and 12 weeks for detailed analysis of haematopoietic tissues.

Animals rescued by Lig1 null cells are anaemic with macrocytosis and reticulocytosis
Although all surviving animals were overtly healthy, with stable bodyweights, when blood samples were taken 4 weeks after irradiation it was found that animals rescued with Lig1 null cells were anaemic. Haematocrits for recipients of wild-type cells were in the normal range (42-50%), but the mean value for recipients of null cells was only 26%. The reduced haematocrit was accompanied by macrocytosis (enlarged erythrocytes) and reticulocytosis (increased numbers of immature erythrocytes). As the haematocrits in animals rescued by Lig1 null cells dropped as the experiment progressed, the proportion of reticulocytes increased. These data indicated that a high proportion of red cells was being released prematurely into the circulation and that the situation was deteriorating with time in animals rescued by Lig1 null cells.

Lig1 null cells contribute to all haematopoietic tissues
Animals rescued by Lig1 null cells had enlarged spleens (splenomegaly) compared with animals rescued by wild-type cells. This was reflected in an increase in the number of spleen cells recovered (Table 1). However, reduced numbers of cells were recovered from all other haematopoietic tissues removed from animals rescued by null as opposed to wild-type cells. This hypoplasia was most severe in bone marrow, which has nearly five-fold fewer cells.


View this table:
[in this window]
[in a new window]
 
Table 1. Contribution of wild-type and Lig1 null donor cells to haematopoietic tissues of rescued animals

 

Quantitative PCR for Zfy-1 on DNA prepared from haematopoietic tissues of rescued animals was used to estimate the contribution of transplanted cells to each tissue (Table 1). High contributions (30-60%) of donor (male) cells were detected in all recipient (female) tissues from animals rescued with wild-type cells. These values are never 100% because there is always some recovery of the lethally irradiated recipient's haematopoietic system (Micklem et al., 1987Go). Donor-derived cells were also detected in all haematopoietic tissues from animals rescued by Lig1 null cells but, apart from bone marrow and spleen, the contribution of null cells to repopulated tissues was lower than wild-type cells.

To determine whether this defect affected all haematopoietic lineages, we analysed haematopoietic tissues from rescued mice by flow cytometry using antibodies to: B220 (expressed on cells committed to the B lymphoid lineage); IgM and IgD (present on mature B lymphocytes which have undergone V(D)J recombination); CD4 and CD8 (present on thymocytes); TCR{alpha}ß (present on thymocytes with rearrangement of the T cell receptor gene); CD5 (present on T cells and a subset of B cells); CD45 (present on non-erythroid haematopoietic cells); GR1 (present on granulocytes); and Ter-119 (present on erythroid cells). The staining profiles from mice rescued with Lig1 null cells were similar to, and in many cases indistinguishable from, wild-type controls. An accurate determination of the number of cells expressing a particular marker(s) in a particular haematopoietic tissue was impossible because of the low numbers of labelled cells counted but, in general, cells of all lineages were present in reduced numbers in animals rescued with Lig1 null cells compared with animals rescued by wild-type cells. The one notable exception was the spleen where the number of Ter-119-expressing (erythroid) cells was higher in the enlarged spleens from animals rescued with Lig1 null cells. These data indicate that Lig1 null haematopoietic stem cells can contribute to all lineages, but in lower numbers than control cells.

Lig1 null primary mouse fibroblasts are viable but have an elevated level of chromosome instability
To investigate the properties of DNA ligase I null cells in vitro, primary embryonic fibroblast cultures were established from E12.5 embryos obtained from matings between animals heterozygous for the original Lig1- targeted allele (Bentley et al., 1996Go). Cultures isolated from Lig1-/- embryos grew more slowly than control cultures from Lig1+/+ embryos (generation time ~48 hours for mutant cultures compared to ~36 hours for controls; data not shown), but flow cytometry on propidiumiodide stained nuclei from cultures (passage 2-passage 5) showed the same cell cycle distribution for both genotypes (data not shown). Following a 2 hour pulse with BrdU, to identify cells in S-phase, 42±5% of cells from two independent control cultures (passage 2) showed nuclei stained with an anti-BrdU antibody. The corresponding value for three independent mutant cultures was only slightly lower (37±2%), confirming the similar cell cycle characteristics.

Defects in pathways involved in DNA maintenance are generally associated with genomic instability (Hoeijmakers, 2001Go). To investigate the possibility that DNA ligase I deficiency may result in chromosome breakage and loss, we measured the frequency of micronucleus formation in primary cultures of Lig1 null and control embryonic fibroblasts. The mean frequency of micronuclei in six independent wild-type cultures (ranging from passage 2-5) was 0.49±0.21%. The corresponding frequency from six independent Lig1 null cultures was four-fold higher, 2.00±0.79%. This difference was highly significant (p=0.001 by Student's t test).

Both wild-type and DNA ligase I null primary cultures senesced rapidly. To facilitate further analysis of DNA ligase I null cells, two spontaneously immortalised lines, PFL10 and PFL13, were isolated. Although the immortalised DNA ligase I null lines grew well in culture they were not as robust as wild-type lines. They were more difficult to establish from frozen stocks, did not plate well at low densities and their generation time was longer than control cultures (PFL13 ~36 hours, PFL10 ~48 hours, compared with ~24 hours for the wild-type PF20 control). DNA ligase I has been implicated in a number of different repair reactions and, a priori, a DNA repair deficiency would be the most likely explanation for the genome instability in Lig1 null primary fibroblasts. Consequently we used the immortalised cell lines to assess the sensitivity of DNA ligase I null cells to a range of DNA damaging agents.

DNA ligase I is not essential for nucleotide excision repair
The human DNA ligase I point mutant cell line, 46BR, has been reported to show increased sensitivity to a range of DNA damaging agents, including UV light (Teo et al., 1983Go), and in vitro reconstitution of NER utilises purified DNA ligase I (Aboussekhra et al., 1995Go). However, in the UV survival experiment shown in Fig. 3A, the survival curves for all ligase mutant and control cell lines were very similar. The human 46BR point mutant was only marginally more sensitive than its species control (MRC5). Similarly, the two mouse Lig1 null cell lines were only slightly more sensitive than the mouse (PF20) control. When these curves are compared with that of a mouse NER mutant (PF24, Ercc1-deficient) (Melton et al., 1998Go), it is clear that DNA ligase I is not essential for NER: the D50 for PF24 was 1.5 Jm-2, whereas it was 7 Jm-2 for PFL10 and PFL13.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 3. Survival of DNA-ligase-I-deficient cells exposed to the following DNA damaging agents (A) UV; (B) EMS; (C) 3-aminobenamide (3-AB); and (D) {gamma}-irradiation. Mean survival±s.e.m. is shown relative to non-treated controls. {blacksquare}, mouse wild-type (PF20); {blacktriangleup}, mouse Lig1 null (PFL13); {blacktriangledown}, mouse Lig1 null (PFL10); {square}, human wild-type (MRC5); {circ}, human LIG1 point mutant (46BR); closed hexagon, mouse Ercc1 null (PF24).

 

DNA ligase I is not essential for repair of alkylation damage
DNA ligase I is involved in the long-patch form of BER, and 46BR cells have been found to show increased sensitivity to alkylating agents (Teo et al., 1983Go). Survival curves for EMS are shown in Fig. 3B. The 46BR point mutant was five-fold more sensitive to EMS than MRC5 (D50 120 µM compared to 650 µM for MRC5). All the mouse lines were more resistant to EMS than the human control, with the two null lines (PFL10 and PFL13) indistinguishable from the PF20 control. Thus, as predicted from the existence of alternate pathways, DNA ligase I is not essential for repair of damage induced by alkylating agents.

Mouse DNA ligase I null cells are not hypersensitive to 3-aminobenzamide
Poly(ADP-ribose) polymerase (PARP) binds to DNA strand breaks and facilitates DNA ligation (Satoh and Lindahl, 1992Go). 3-aminobenzamide is a specific inhibitor of PARP that causes an accumulation of strand breaks. The reported increased sensitivity of 46BR cells to 3-aminobenzamide (Lehmann et al., 1988Go) was confirmed in Fig. 3C. 46BR cells were two-fold more sensitive than MRC5 (D50 3 mM compared to 7 mM for MRC5). Although the mouse lines again showed greater resistance to 3-aminobenzamide, the Lig1 null lines (PFL10 D50 6 mM, PFL13 4.5 mM) were 1.5-fold more sensitive than the control (PF20 8.3 mM).

DNA ligase I is not essential for repair of ionising radiation damage
Although DNA ligase IV is the key ligase for double-strand break repair, 46BR cells have been reported to show increased sensitivity to ionising radiation (Teo et al., 1983Go). The increased sensitivity of 46BR compared with MRC5 was confirmed in Fig. 3D (46BR D50 5.7 Gy, MRC5 9 Gy). The two mouse Lig1 null lines were not more sensitive than the PF20 control. The survival curve for PFL13 (D50 8.5 Gy) was very similar to PF20 (D50 9 Gy). The curve for PFL10 was shallower and reproducibly lacked a conventional shoulder, resulting in an apparently higher D50 (15 Gy) than the wild-type control.

Replication intermediates accumulate in Lig1 null cells
In the absence of a clear DNA repair defect in Lig1 null cells, we next investigated DNA replication as a possible explanation for the genome instability. 40-300 base DNA replication intermediates (Okazaki fragments) are extremely transient in wild-type cells, but can be readily detected in 46BR cells by giving short pulses of [3H]-thymidine, then chasing with unlabelled thymidine and measuring radioactivity in single-stranded DNA fractions of different sizes (Henderson et al., 1985Go). The results of such an experiment for fractions ranging from <0.2 to >23 kb are summarised in Fig. 4. Following the pulse, <2% of the total radioactivity incorporated into DNA in both wild-type human (MRC5) and mouse (PF20) cells was present in DNA molecules <2.0 kb and that which was present was rapidly chased into larger fractions. In contrast 23% of the radioactivity in the human DNA ligase I point mutant (46BR) was in the <2.0kb fraction after the pulse, and this did not completely disappear during the 30 minute chase. The situation in the mouse Lig1 null line (PFL13) was intermediate between 46BR and the wild-type controls. 10% of the radioactivity was in the <2.0 kb fraction after the pulse, but this disappeared completely after a 15 minute chase. Thus, the ligation of replication intermediates is delayed in Lig1 null mouse fibroblasts, but the delay is not so pronounced as in the human LIG1 point mutant.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. Accumulation of DNA replication intermediates in DNA-ligase-I-deficient cells. Cultures were subjected to a short pulse with [3H]-thymidine followed by a chase of up to 30 minutes. Cells were then harvested, lysed in agarose plugs and subjected to alkaline gel electrophoresis. Fractions from <0.2 kb to >23 kb were collected and counted. The figure shows the percentage of total radioactivity present in single-stranded DNA fragments <2.0kb for each cell line. Values shown are means±s.e.m. {blacksquare}, mouse wild-type (PF20); {triangleup}, human wild-type (MRC5); {square}, mouse Lig1 null (PFL13); [UNK], human LIG1 point mutant (46BR).

 

Sister chromatid exchange rates are normal in Lig1 null mouse fibroblasts
One of the characteristics of Bloom's syndrome is a very high level of reciprocal interchanges between homologous chromatids (sister chromatid exchange, SCE). 46BR cells also show an increased frequency of SCEs and are hypersensitive to the induction of SCE by DNA damaging agents (Henderson et al., 1985Go). Because Lig1 null fibroblasts showed increased chromosome instability, as determined by micronucleus formation, we also measured the spontaneous incidence of SCE in a range of primary cultures and immortalised cell lines (Table 2). All mouse and human wild-type samples displayed SCE rates consistent with previous studies (~10 SCEs per metaphase) (e.g. McDaniel and Schultz, 1992Go). As expected, the mean number of SCEs per metaphase was significantly elevated (2.4-fold) in 46BR cells compared with the human (MRC5) control (Mann-Whitney U test, p <0.05). However, there was no significant difference in SCE frequency between primary (Lig1-/-) or immortalised (PFL13) DNA Lig1 null cells compared with wild-type controls (Lig1+/+ and PF20).


View this table:
[in this window]
[in a new window]
 
Table 2. The frequency of sister chromatid exchanges in human and mouse fibroblast cells

 

Levels of DNA ligases III and IV are not increased to compensate for DNA ligase I deficiency
DNA ligase I is highly expressed in proliferating cells, but corresponding levels of other DNA ligases are generally much lower. To investigate the possibility that increased expression of DNA ligases III or IV might be compensating for DNA ligase I deficiency, the levels of Lig3 and Lig4 transcripts and proteins were determined in mid-gestation embryos (Lig1+/+,+/-,-/-) and immortalised cell lines (PF20, PFL10, PFL13). No differences in Lig3 and Lig4 transcripts were observed (data not shown). Ligase III and ligase IV proteins were readily detected by the antisera used, but there was no indication that the level of either was altered by DNA ligase I deficiency (Fig. 5).



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 5. Levels of DNA ligases III and IV are unaffected by DNA ligase I deficiency. Western analysis of protein (100 µg) extracted from mid-gestation embryos and immortalised embryonic fibroblasts. (A) Panel probed with TL25 rabbit polyclonal antibody raised against recombinant full-length human DNA ligase III. The position of the 103 kDa DNA ligase III is indicated by the arrow. (B) Panel probed with TL18 rabbit polyclonal antibody raised against a C- terminal peptide of human DNA ligase IV. The position of the 96 kDa DNA ligase IV is indicated by the arrow. The mobility of Mr markers (kDa) on the same gels is shown.

 


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Do the Lig1 targeted alleles have some residual function?
Given the key role of DNA ligase I in replication (Timson et al., 2000Go) and the report that DNA ligase I was essential for the viability of cultured mammalian cells (Petrini et al., 1995Go), the issue of possible residual enzyme activity was critical for our understanding of the phenotype of our Lig1 knockout mice and for the role of DNA ligase I in vivo. In both of our Lig1 knockout alleles, targeting has removed the 3' end of the gene, comprising exons 23-27 and encoding 174 residues of the 916 amino acid protein. A Lig1 cDNA probe containing exons 8-27 had previously failed to detect a transcript from the original (Lig1-(#53)) targeted allele by northern blotting, and two different antibodies to epitopes in the N- and C-terminal regions of DNA ligase I could not detect any DNA ligase I protein in extracts from mutant embryos (Bentley et al., 1996Go). Although we detected a rare fusion transcript from the original Lig1-(#53) allele and a more abundant fusion transcript from the new Lig1-(#12) allele, there was no evidence for any DNA ligase I being produced in either case.

The low level of mRNA from the Lig1-(#53) allele, detectable only by RT-PCR, could be because of a low level of transcription or the instability of the hybrid transcript. We have previously shown that transcription from the PGK-HPRT(RI) minigene is particularly unstable at the Lig1 locus, with the mouse Pgk promoter becoming heavily methylated (Melton et al., 1997Go). Transcription from the mouse Hprt promoter in the DWM110 minigene, inserted at the identical position in the Lig1-(#12) allele, was not similarly affected. Perhaps the silencing of the PGK-HPRT(RI) minigene extends to the Lig1 promoter itself to result in the low level of transcripts from the Lig1-(#53) allele.

Despite the presence of abundant transcripts from the new Lig1-(#12) targeted allele, the phenotype of mutant embryos was identical to the one we have previously reported for the original Lig1-(#53) allele. This strengthens the argument that our Lig1 targeted alleles produce no functional DNA ligase I because, if there were residual ligase activity from the Lig1-(#53) allele, greater activity and a milder phenotype would be expected from the Lig1-(#12) allele with its much higher level of Lig1 transcripts. There is additional evidence that, even if a DNA ligase I fusion protein were produced, it would have no catalytic activity. Removal of more than 16 amino acids from the C-terminus of human DNA ligase I rendered the protein enzymatically inactive (Kodama et al., 1991Go). Any fusion protein produced from our targeted alleles would lack the C-terminal 174 residues and should therefore be catalytically inactive. With the high levels of DNA ligase I activity normally found in proliferating cells, we consider it unlikely that an undetectable amount of a theoretical protein that should have no activity could meet the catalytic requirements for ligase I activity in early mouse embryos. Consequently, we feel justified in describing our Lig1 targeted alleles as effective nulls for DNA ligase I.

DNA ligase I is not essential for mammalian cell viability
How can our results be reconciled with the report that DNA ligase I is essential for mammalian cell viability (Petrini et al., 1995Go)? This conclusion arose from the failure to isolate mouse embryonic stem (ES) cells homozygous for a Lig1 targeted allele following in vitro selection for gene conversion events in ES cells heterozygous for the targeted allele. We consider that this failure could result instead from the inherent difficulty of isolating ES cells homozygous for a disabling mutation under stringent selection conditions where single Lig1 null cells may be viable but unable to proliferate sufficiently at low cell densities to form a colony and be detected. The fragility of our immortalised Lig1 null fibroblasts, particularly at low plating densities, would support this suggestion. The failure of Petrini et al. to isolate ES cells homozygous for the Lig1 targeted allele could also be because of the targeting strategy employed, which replaced exons 17-19 with a selectable marker. Although any product from this targeted allele would be catalytically inactive with the probes and antisera used, Petrini et al. did not exclude the possibility that an altered protein was produced from their targeted allele. We suggest that the presence of an inactive DNA-ligase-I-derived protein may actually hamper cell survival, possibly by preventing another ligase from acting instead of DNA ligase I (see below).

Lig1 null cells can repopulate the haematopoietic system of lethally irradiated recipients
Lig1 null embryos die as a consequence of failure to make the transition in erythropoiesis from yolk sac to foetal liver, despite the presence of haematopoietic progenitors in foetal liver. This led us to propose a model involving a quantitative, rather than a qualitative, defect in haematopoiesis in Lig1 null embryos, which only manifested itself under the extremely high requirement for erythropoiesis in foetal liver. One prediction of this model that we have gone on to demonstrate is that Lig1 null foetal liver cells, when transplanted in sufficient quantity, should be able to repopulate the haematopoietic system and rescue lethally irradiated recipients. Pooled Lig1 null liver suspensions were as effective as individual wild-type liver suspensions in effecting rescue. The progressive anaemia and elevated levels of reticulocytes in animals rescued with Lig1-/- cells indicate that Lig1 null haematopoietic cells are unable to meet demand for erythrocyte production. Similarly, cell numbers in all haematopoietic tissues from animals rescued by Lig1 null cells were reduced compared with animals rescued by wild-type cells. However, all lineages were present in all haematopoietic tissues examined from animals rescued by Lig1 null cells. The enlarged spleens in animals rescued by Lig1 null cells were consistent with the known kinetics of haematopoietic repopulation coupled with the normal physiological response to chronic anaemia. These observations are in keeping with the phenotype of the developing Lig1 null embryos themselves and are consistent with a quantitative deficiency relating to reduced proliferation rather than a qualitative block in any haematopoietic lineage. In particular, the normal ratio of B220 to IgM and IgD expression observed supports previous in vitro observations in 46BR cells (Petrini et al., 1994Go) that DNA ligase I is not necessary for V(D)J recombination.

DNA ligase I is not essential for DNA repair
The human LIG1 point mutant 46BR has been reported to show increased UV sensitivity (Teo et al., 1983Go), although we could not demonstrate this in our study. DNA ligase I is a component of the NER reaction reconstituted in vitro (Aboussekhra et al., 1995Go), but our UV survival experiments on Lig1 null mouse fibroblasts showed clearly that DNA ligase I was not essential for NER. Similarly, although DNA ligase I is involved in the long-patch form of BER (Lindahl et al., 1997Go) and 46BR cells show increased sensitivity to alkylating agents (Teo et al., 1983Go), the EMS survival curves for our Lig1 null mouse fibroblasts were indistinguishable from the wild-type mouse control. Thus, as perhaps could be predicted from the involvement of DNA ligase III in the predominant short-patch form of BER, DNA ligase I is also not essential for repair of alkylation damage. DNA ligase IV is essential for double-strand break repair (Timson et al., 2000Go), but 46BR cells have been reported to show increased sensitivity to ionising radiation (Teo et al., 1983Go), and DNA ligase I is active in the V(D)J recombination mechanism in vitro (Ramsden et al., 1997Go). Our data provide no evidence for a role for DNA ligase I in double-strand break repair. In fact, the {gamma}-irradiation survival curve for PFL10, our slowest growing Lig1 null line, reproducibly indicated a slight increase in survival compared with the control, although this is more likely to be as a consequence of the slower growth rate and the resulting requirement to plate these cells at a higher density rather than a real increase in survival. Hence, in contrast to results from 46BR cells, we were unable to detect a measurable NER, BER or double-strand break repair defect in Lig1 null cells. Lig1 null cells did show a mildly increased sensitivity to 3-aminobenzamide compared with wild-type, although not to the level of 46BR cells. 3-aminobenzamide is an inhibitor of PARP. Although its precise role remains to be defined (for a review, see Herceg and Wang, 2001Go), PARP binds to DNA strand breaks and is known to stimulate DNA ligase activity (Satoh and Lindahl, 1992Go). Differences in 3-aminobenzamide sensitivity between 46BR and Lig1 null cells may reflect an underlying difference in the number of DNA strand breaks occurring within the two cell types, correlating with observed differences in DNA replication.

Replication intermediates accumulate in Lig1 null cells
46BR cells are defective in the joining of Okazaki fragments (Prigent et al., 1994Go), and this was clearly evident in our pulse-chase experiment as an accumulation after the pulse of short single-stranded DNA fragments that were slow to chase into high molecular weight DNA. The Lig1 null cells also showed an accumulation of replication intermediates, but the accumulation was not as marked as in 46BR cells and the intermediates were chased away more rapidly. This accumulation of replication intermediates in Lig1 null cultured cells is compatible with the slower growth rate that we have observed and could provide the basis for the failure of Lig1 null embryos when the replicative demands of erythropoiesis are highest.

Increased genome instability in Lig1 null cells
One aim of our work with DNA ligase I is to produce a mouse model for the 46BR patient to study the relationship between DNA ligase I deficiency and cancer susceptibility. Since genome instability plays an important role in cancer development, we measured instability and found a four-fold higher level in primary cultures of Lig1 null embryonic fibroblasts compared with wild-type controls. The micronucleus assay used detects whole chromosomes or chromosome fragments that have failed to segregate correctly at mitosis. The increased frequency of micronuclei was not mirrored in a similar increase in sister chromatid exchanges in Lig1 null cells.

Genome instability usually results from mutation in cell cycle control genes, such as p53 (Levine, 1997Go), or from DNA repair deficiency (Hoeijmakers, 2001Go). The importance of NHEJ components, including DNA ligase IV, in the maintenance of genome stability has been demonstrated (Ferguson et al., 2000Go). The genome instability in Lig1 null cells could result directly from the altered DNA replication, particularly since we have no evidence for any DNA repair defect that could also contribute to the instability. As such, Lig1 null cells would represent an unusual situation where there is genome instability in the absence of sensitivity to DNA damaging agents. A similar explanation could apply to at least a component of the instability observed in PARP-deficient cells (for a review, see Herceg and Wang, 2001Go).

Compensation for DNA ligase I deficiency
Another DNA ligase must be compensating for the lack of DNA ligase I in our Lig1 null cells and embryos. We found no evidence for a compensatory increase in expression of the two obvious candidates, DNA ligases III and IV, but this does not exclude their involvement since both were readily detected and so increased expression may not be a prerequisite.

Lig1 null mouse cells were less sensitive to UV, EMS and {gamma}-irradiation than human 46BR cells when compared with their species controls. The accumulation of replication intermediates was also more pronounced in 46BR than Lig1 null cells, and only 46BR cells showed an elevated frequency of SCEs. This could be caused by ligase I playing different roles in the two species. Alternatively, in many respects, it may be better to have a complete absence of ligase I, rather than produce a partially functional enzyme as is the case with the 46BR cell line. This is not surprising given that interaction with PCNA has been demonstrated to be important for DNA ligase I function in joining Okazaki fragments and in long-patch BER (Levin et al., 2000Go). Perhaps only in the absence of DNA ligase I is another DNA ligase able to effectively complement for the missing ligase activity. Our results emphasise that the 46BR patient is a special case of DNA ligase I deficiency and that the 46BR phenotype is not necessarily representative of the effects of the complete absence of DNA ligase I. Nevertheless it must be remembered that, as with Lig4 (Frank et al., 1998Go; Barnes et al., 1998Go), the Lig1 null mutation is embryonic lethal, and so the importance of DNA ligase I should not be underestimated.


    Acknowledgments
 
We are grateful to C. McEwan for targeting vector construction. We thank T. Lindahl and D. Barnes (ICRF, Clare Hall Laboratories) for antibodies to DNA ligases. D.J.B. was supported by a BBSRC PhD studentship. This work was supported by a project grant (SP2095/0104) from The Cancer Research Campaign to D. W. M.


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Aboussekhra, A., Biggerstaff, M., Shivji, M. K. K., Vilpo, J. A., Moncollin, V., Podust, V. N., Protic, M., Hubscher, U., Egly, J. M. and Wood, R. D. (1995). Mammalian DNA nucleotide excision repair reconstituted with purified protein components. Cell 80,859 -868.[Medline]

Barnes, D. E., Tomkinson, A. E., Lehmann, A. R., Webster, A. D. B. and Lindahl, T. (1992). Mutations in the DNA ligase I gene in an individual with immunodeficiencies and cellular hypersensitivity to DNA-damaging agents. Cell 69,495 -504.[Medline]

Barnes, D. E., Stamp, G., Rosewell, I., Denzel, A. and Lindahl, T. (1998). Targeted disruption of the gene encoding DNA ligase IV leads to lethality in embryonic mice. Curr. Biol. 8,1395 -1398.[Medline]

Bentley, D. J., Selfridge, J., Millar, J. K., Samuel, K., Hole, N., Ansell, J. D. and Melton, D. W. (1996). DNA ligase I is required for foetal liver erythropoiesis but is not essential for mammalian cell viability. Nat. Genet. 13,489 -491.[Medline]

Cappelli, E., Taylor, R., Cevasco, M., Abbondandolo, A., Caldecott, K. and Frosina, G. (1997). Involvement of XRCC1 and DNA ligase III gene products in DNA base excision repair. J. Biol. Chem. 272,23970 -23975.[Abstract/Free Full Text]

Ellis, N. A., Groden, J., Ye, T.-E., Straughen, J., Lennon, D. J., Ciocci, S., Proytcheva, M. and German, J. (1995). The Bloom's syndrome gene product is homologous to RecQ helicases. Cell 83,655 -666.[Medline]

Ferguson, D. O., Sekiguchi, J. M., Chang, S., Frank, K. M., Gao, Y., DePinho, R. A. and Alt, F. W. (2000). The nonhomologous end-joining pathway of DNA repair is required for genomic stability and the suppression of translocations. Proc. Natl. Acad. Sci. USA 97,6630 -6633.[Abstract/Free Full Text]

Frank, K. M., Sekiguchi, J. M., Seidl, K. J., Swat, W., Rathbun, G. A., Cheng, H. L., Davidson, L., Kangaloo, L. and Alt, F. W. (1998). Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV. Nature 396,173 -177.[Medline]

German, J. (1993). Bloom Syndrome: A mendelian prototype of somatic mutational disease. Medicine 72,393 -406.[Medline]

Goto, K., Maeda, S., Kano, Y. and Sugiyama, T. (1978). Factors involved in differential Giemsa-staining of sister chromatids. Chromosoma 66,351 -359.[Medline]

Grawunder, U., Zimmer, D., Fugmann, S., Schwarz, K. and Lieber, M. R. (1998). DNA ligase IV is essential for V(D)J recombination and DNA double-strand break repair in human precursor lymphocytes. Mol. Cell 2, 477-484.[Medline]

Henderson, L. M., Arlett, C. F., Harcourt, S. A., Lehmann, A. R. and Broughton, B. C. (1985). Cells from an immunodeficient patient (46BR) with a defect in DNA ligation are hypomutable but hypersensitive to the induction of sister chromatid exchanges. Proc. Natl. Acad. Sci. USA 82,2044 -2048.[Abstract/Free Full Text]

Herceg, Z. and Wang, Z.-Q. (2001). Functions of poly(ADP-ribose) polymerase (PARP) in DNA repair, genomic integrity and cell death. Mutat. Res. 477,97 -110.[Medline]

Hoeijmakers, J. H. J. (2001). Genome maintenance mechanisms for preventing cancer. Nature 411,366 -374.[Medline]

Jessop, J. K. and Melton, D. W. (1995). Comparison between cDNA clones encoding murine DNA ligase I. Gene 160,307 -308.[Medline]

Kodama, K.-I., Barnes, D. E. and Lindahl, T. (1991). In vitro mutagenesis and functional expression in Escherichia coli of a cDNA encoding the catalytic domain of human DNA ligase I. Nucleic Acids Res. 19,6093 -6099.[Abstract/Free Full Text]

Kunieda, T., Xian, M. W., Kobayashi, E., Imamichi, T., Moriwaki, K. and Toyoda, Y. (1992). Sexing of mouse preimplantation embryos by detection of Y-chromosome-specific sequences using polymerase chain reaction. Biol. Reprod. 46,692 -697.[Abstract]

Lehmann, A. R., Willis, A. E., Broughton, B. C., James, M. R., Steingrimsdottir, H., Harcourt, S. A., Arlett, C. F. and Lindahl, T. (1988). Relation between the human fibroblast strain 46BR and cell lines representative of Bloom's syndrome. Cancer Res. 48,6353 -6357.

Levin, D. S., McKenna, A. E., Motycka, T. A., Matsumoto, Y. and Tomkinson, A. E. (2000). Interaction between PCNA and DNA ligase I is critical for joining of Okazaki fragments and long-patch base-excision repair. Curr. Biol. 10,919 -922.[Medline]

Levine, A. J. (1997). p53, the cellular gatekeeper for growth and division. Cell 88,323 -331.[Medline]

Lindahl, T., Karran, P. and Wood, R. D. (1997). DNA excision repair pathways. Curr. Opin. Genet. Dev. 7, 158-169.[Medline]

Mackenney, V. J., Barnes, D. E. and Lindahl, T. (1997). Specific function of DNA ligase I in simian virus 40 DNA replication by human cell-free extracts is mediated by the amino-terminal non-catalytic domain. J. Biol. Chem. 272,11550 -11556.[Abstract/Free Full Text]

Magin, T. M., McWhir, J. and Melton, D. W. (1992). A new mouse embryonic stem cell line with good germline contribution and gene targeting frequency. Nucleic Acids Res. 20,3795 -3796.[Free Full Text]

McDaniel, L. D. and Schultz, R. A. (1992). Elevated sister chromatid exchange phenotype of Bloom syndrome cells is complemented by human chromosome 15. Proc. Natl. Acad. Sci. USA 89,7968 -7972.[Abstract/Free Full Text]

McWhir, J., Selfridge, J., Harrison, D. J., Squires, S. and Melton, D. W. (1993). Mice with DNA repair gene (ERCC-1) deficiency have elevated levels of p53, liver nuclear abnormalities and die before weaning. Nat. Genet. 5, 217-224.[Medline]

Melton, D. W., Ketchen, A.-M. and Selfridge, J. (1997). Stability of Hprt marker gene expression at different gene-targeted loci: observing and overcoming a position effect. Nucleic Acids Res. 25,3937 -3943.[Abstract/Free Full Text]

Melton, D. W., Ketchen, A.-M., Nuñez, F., Bonatti-Abbondandolo, S., Abbondandolo, A., Squires, S. and Johnson, R. T. (1998). Cells from Erccl-deficient mice show increased genome instability and a reduced frequency of S-phase-dependent illegitimate chromosome exchange, but a normal frequency of homologous recombination. J. Cell Sci. 111,395 -404.[Abstract]

Micklem, H. S., Lennon, J. E., Ansell, J. D. and Gray, R. A. (1987). Numbers and dispersion of repopulating haematopoietic cell clones in radiation chimeras as functions of injected cell dose. Exp. Hematol. 15,251 -257.[Medline]

Perry, P. and Wolff, S. (1974). New Geimsa method for the differential staining of sister chromatids. Nature 251,156 -158.[Medline]

Petrini, J. H. H., Donovan, J. W., Dimare, C. and Weaver, D. T. (1994). Normal V(D)J coding junction formation in DNA ligase I deficiency syndrome. J. Immunol. 152,176 -183.[Abstract]

Petrini, J. H. J., Xiao, Y. H. and Weaver, D. T. (1995). DNA ligase-I mediates essential functions in mammalian cells. Mol. Cell. Biol. 15,4303 -4308.[Abstract]

Prigent, C., Satoh, M. S., Daly, G., Barnes, D. E. and Lindahl, T. (1994). Aberrant DNA repair and DNA replication due to an inherited enzymatic defect in human DNA ligase I. Mol. Cell. Biol. 14,310 -317.[Abstract/Free Full Text]

Ramsden, D. A., Paull, T. T. and Gellert, M. (1997). Cell-free V(D)J recombination. Nature 388,488 -491.[Medline]

Sambrook, J., Fritsch, E. F. and Maniatis, T. (eds) (1989). Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, New York.

Satoh, M. S. and Lindahl, T. (1992). Role of poly(ADP-ribose) formation in DNA repair. Nature 356,356 -358.[Medline]

Shivji, M. K. K., Podust, V. N., Hubscher, U. and Wood, R. D. (1995). Nucleotide excision repair DNA synthesis by DNA polymerase epsilon in the presence of PCNA, RFC, and RPA. Biochem. 35,5011 -5017.

Somia, N. V., Jessop, J. K. and Melton, D. W. (1993). Phenotypic correction of a human cell line (46 BR) with aberrant DNA ligase I activity. Mutat. Res. 294, 51-58.[Medline]

Teo, I. A., Arlett, C. F., Harcourt, S. A., Priestley, A. and Broughton, B. C. (1983). Multiple hypersensitivity to mutagens in a cell strain (46BR) derived from a patient with immuno-deficiencies. Mutat. Res. 107,371 -386.[Medline]

Thompson, S., Clarke, A. R., Pow, A. M., Hooper, M. L. and Melton, D. W. (1989). Germ line transmission of a corrected Hprt gene produced by gene targeting in embryonic stem cells. Cell 56,313 -321.[Medline]

Timson, D. J., Singleton, M. R. and Wigley, D. B. (2000). DNA ligases in the repair and replication of DNA. Mutat. Res. 460,301 -318.[Medline]

Tom, S., Henricksen, L. A., Park, M. S. and Bambara, R. A. (2001). DNA ligase I and proliferating cell nuclear antigen form a functional complex. J. Biol. Chem. 276,24817 -24825.[Abstract/Free Full Text]

Tomescu, D., Ha, T., Kavanagh, G., Campbell, H. and Melton, D. W. (2001). Nucleotide excision repair gene XPD polymorphisms and predisposition to melanoma. Carcinogenesis 22,403 -408.[Abstract/Free Full Text]

Tomkinson, A. E., Lasko, D. D., Daly, G. and Lindahl, T. (1990). Mammalian DNA ligases. Catalytic domain and size of DNA ligase I. J. Biol. Chem. 265,12611 -12617.[Abstract/Free Full Text]

Waga, S., Bauer, G. and Stillman, B. (1994). Reconstitution of complete SV40 DNA replication with purified replication factors. J. Biol. Chem. 269,10923 -10935.[Abstract/Free Full Text]

Webster, A. D. B., Barnes, D. E., Arlett, C. F., Lehmann, A. R. and Lindahl, T. (1992). Growth retardation and immunodeficiency in a patient with mutations in the DNA ligase I gene. Lancet 339,1508 -1509.[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. Lopez Castel, A. E. Tomkinson, and C. E. Pearson
CTG/CAG Repeat Instability Is Modulated by the Levels of Human DNA Ligase I and Its Interaction with Proliferating Cell Nuclear Antigen: A DISTINCTION BETWEEN REPLICATION AND SLIPPED-DNA REPAIR
J. Biol. Chem., September 25, 2009; 284(39): 26631 - 26645.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Kenyon and S. L. Gerson
The role of DNA damage repair in aging of adult stem cells
Nucleic Acids Res., December 26, 2007; (2007) gkm1064v1.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Muylaert and P. Elias
Knockdown of DNA Ligase IV/XRCC4 by RNA Interference Inhibits Herpes Simplex Virus Type I DNA Replication
J. Biol. Chem., April 13, 2007; 282(15): 10865 - 10872.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
I. V. Martin and S. A. MacNeill
Functional analysis of subcellular localization and protein-protein interaction sequences in the essential DNA ligase I protein of fission yeast
Nucleic Acids Res., January 29, 2004; 32(2): 632 - 642.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Y. Einav, E. Shistik, M. Shenfeld, A. H. Simons, D. W. Melton, and D. Canaani
Replication and episomal maintenance of Epstein-Barr virus-based vectors in mouse embryonal fibroblasts enable synthetic lethality screens
Mol. Cancer Ther., November 1, 2003; 2(11): 1121 - 1128.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Harrison, A.-M. Ketchen, N. J. Redhead, M. J. O'Sullivan, and D. W. Melton
Replication Failure, Genome Instability, and Increased Cancer Susceptibility in Mice with a Point Mutation in the DNA Ligase I Gene
Cancer Res., July 15, 2002; 62(14): 4065 - 4074.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bentley, D. J.
Right arrow Articles by Melton, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bentley, D. J.
Right arrow Articles by Melton, D. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?