|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
Genome Damage and Stability Centre, School of Biological Sciences, University of Sussex, Falmer, Brighton, BN1 9QG, UK
* Author for correspondence (e-mail: f.z.watts{at}sussex.ac.uk )
Accepted 6 January 2002
| Summary |
|---|
|
|
|---|
Key words: SUMO, Pmt3, Ulp1, Cell cycle
| Introduction |
|---|
|
|
|---|
The S. pombe rad31 and hus5 genes, which were initially
proposed to be involved in SUMO modification as a result of their high level
of sequence identity to the S. cerevisiae AOS1 and UBC9
genes (al-Khodairy et al.,
1995
; Johnson et al.,
1997
; Shayeghi et al.,
1997
; Tanaka et al.,
1999
), have recently been shown to be required for SUMO
modification by their activity in an in vitro SUMO (Pmt3) modification system
(Ho et al., 2001
).
Specifically, the rad31 and hus5 genes encode one subunit of
the heterodimeric activator and the conjugator, respectively, for the S.
pombe SUMO protein, Pmt3. Pmt3 is a member of a Ubl (ubiquitin-like)
family, which has been identified independently in many organisms, and its
members are known variously as SUMO, PIC1, sentrin and UBL1 in mammalian
cells, as Smt3 in S. cerevisiae and as Pmt3 in S. pombe
(Yeh et al., 2000
).
The Ubls are expressed as precursor molecules that, like ubiquitin, require
C-terminal processing to reveal the double glycine (GG) motif needed for
conjugation to the target lysine residue
(Johnson et al., 1997
). The
conjugation of SUMO and other Ubls such as Rub1/NEDD8 to substrate proteins is
similar to that of ubiquitination and requires activation and conjugation of
the Ubl by E1 and E2 enzymes (Desterro et
al., 1997
; Johnson and Blobel,
1997
). Conjugation is initiated by an activation enzyme (E1),
which, in an ATP-dependent reaction, forms a thiolester linkage with the Ubl.
The Ubl is then transferred to a conjugating enzyme (E2), forming a similar
thiolester linkage, before transfer to a target lysine residue of the
substrate protein. Unlike the E1 required for ubiquitin activation, which is a
monomer, the E1 (or SAE) required for SUMO activation is a heterodimer in
which the two subunits are related to the N- and C-terminal domains of the
ubiquitin E1 enzymes (Johnson et al.,
1997
). In S. pombe, the Rad31 protein acts in conjunction
with Fub2 (Tanaka et al.,
1999
) to form the E1 heterodimer
(Tanaka et al., 1999
;
Ho et al., 2001
).
The mechanism of deconjugation of Ubls from targets is similar to
deconjugation of ubiquitin from its targets, which occurs through the action
of the Dub (de-ubiquitinating) enzymes. It appears that cells contain multiple
SUMO proteases, suggesting that there may be some specificity in their
location and/or action. Recently identified cysteine proteases with
specificity for SUMO/Smt3 hydrolysis in vitro include mammalian SMT3IP1, SUSP1
and SENP1 (Gong et al., 2000
;
Kim et al., 2000
;
Nishida et al., 2000
) and
S. cerevisiae ScUlp1 and ScUlp2
(Li and Hochstrasser, 1999
;
Li and Hochstrasser,
2000
).
Several targets of SUMO modification have been identified in mammalian
systems including RanGAP1, PML, p53 and IkB
(e.g.
Boddy et al., 1996
;
Desterro et al., 1998
;
Gostissa et al., 1999
;
Mahajan et al., 1997
;
Matunis et al., 1998
;
Rodriguez et al., 1999
;
Sternsdorf et al., 1997
), and
although a definitive role for modification has yet to be recognised, most
modified targets are localised in the nucleus or at the nuclear envelope.
Exceptions to this are the S. cerevisiae septins Cdc3, Cdc11 and
Shs1, which are modified by the S. cerevisiae SUMO homologue Smt3 and
are located at the mother/bud neck in a cell-cycle-dependent manner
(Johnson and Blobel,
1999
).
To further our understanding of Pmt3 modification in fission yeast and to facilitate the identification of modified targets, we have initiated a characterisation of the Pmt3- specific proteases in S. pombe. We report here on S. pombe Ulp1 and show that it is a 65 kDa protein that is capable of processing the Pmt3 precursor to produce a protein corresponding in size to that expected of the mature form and is able to function to a limited extent in the removal of Pmt3 from target proteins in cell extracts. The ulp1 null allele is viable and its phenotype is described here. The Ulp1 protein is localised at the nuclear envelope throughout S phase and G2 but is observed within the nucleus during mitosis.
| Materials and Methods |
|---|
|
|
|---|
|
Construction of myc epitope tagged ulp1 strain
A C-terminal myc-epitope-tagged ulp1 strain was generated using
the G418 selectable marker module and methodology described in Bahler et al.
(Bahler et al., 1998
).
Oligonucleotides Ulp1-MH 5' TGTTC-
CTGTTCAGTTTAGTCAAAATGATATGCCTGAACTACGAATCA-
AAATGGCAGCTAGTATTATTGATGCACAAATCTATCGGATCC- CCGGGTTAATTAA 3' and
ulp1-rev 5' ATGCGGGTATTTTTT-
TTTTCAAAAGCTATATTTGCTGAGATTCCTGGATTCAGATTTA-
TTAATTAGAGTATTCCCTGCTAGAATTCGAGCTCGTTTAAA 3' were generated with 80
bases of homology to the target sequence followed by 20 bases of 3'
homology to the plasmid sequence. Integration was confirmed by PCR using the
primers KanMXR 5' CGGATGTGATGTGAGAACTGTATCCTAGC 3' and Ulp1-6
5' TATACTTGTAAGCTTCTCACG 3'. The tagged strain did not display any
obvious growth or morphological abnormalities and thus resembles wild-type
strains.
Cloning and expression of full-length and C-terminally truncated
pmt3
The S. pombe pmt3 sequence was amplified by PCR using the
following primers SEN4: 5' CTGAGAACATATGTCTGAATC 3' and SUMO2:
5' TTGAGAGGATCCACGTATTGG 3' to produce a full-length clone. The
C-terminally truncated Pmt3 ORF (Pmt3-GG) was amplified using primers SEN4 and
pGG: 5' GGATCCTAACCACCTAACTGTTCT 3'. Both ORFs were subsequently
cloned as NdeI-BamHI fragments in the E. coli
expression vector pET15b (Novagen). Full-length and truncated versions of Pmt3
(Pmt3-GG) were expressed with N-terminal 6xHis tags and affinity
purified using Ni2+ agarose according to the manufacturers
instructions (Novagen).
Cloning and expression of Ulp1
The oligonucleotide primers Ulp1X 5' CTCGAGAATGATAGGAAAACGCAATGC
3' and Ulp1S 5' CCCGGGTTGCTGTTGTGCGCATCAGC 3' were used for
PCR to amplify the S. pombe ulp1 coding sequence. A 1.9 kb fragment
was generated and cloned into pGEM5Zf+ for sequencing. The ORF was
then subcloned as an XhoI-SmaI fragment into pRSETB.
6xHis-tagged Ulp1 protein was expressed from the T7 promoter of pRSETB
in E. coli BL21 cells. Cell lysis was performed by sonication, and
Ulp1 was purified on Talon metal affinity resin according to the
manufacturer's instructions (Clontech.) Protein-containing fractions were
pooled and dialysed overnight into 50 mM sodium phosphate pH 7.5, 150 mM NaCl,
1 mM DTT before being snap frozen and stored at 80°C.
Creation of the ulp1 null allele
The ulp1 null allele was created by replacing a 1.1 kb
BamHI-SalI fragment within the ulp1 coding sequence
with the S. pombe ura4 gene. A 2.5 kb XhoI-SmaI
fragment was excised and used to transform a diploid strain. Replacement of
the wild-type allele was confirmed by Southern blot analysis.
Ulp1 protease assays
S. pombe native cell extracts were prepared in cleavage buffer (10
mM sodium phosphate pH 7.0, 150 mM NaCl, 1 mM DTT (Sigma)) from cells grown to
a density of 106 cells/ml in rich medium. Precursor and truncated
Pmt3 (Pmt3-GG, used as a control) were synthesised either in a coupled in
vitro transcription and translation system using the TnT system according to
the manufacturer's instructions (Promega) with [35S]methionine or
purified as 6xHis tag fusion proteins from E. coli BL21
transformed with either pET15b-Pmt3 or pET15b-Pmt3-GG using Ni2+
agarose. Processing and deconjugation assays were carried out in cleavage
buffer in a total volume of 20 µl at 30°C for 30 minutes unless
otherwise stated. Samples were analysed by SDSPAGE. 35S-labelled
proteins were detected using a phosphorimager. Recombinant Pmt3 produced in
E. coli and Pmt3 species in S. pombe cell extracts were
detected by immunoblotting using polyclonal anti-Pmt3 antisera.
Generation of antibodies and immunological methods
A fragment encoding an N-terminally truncated version of Pmt3 (N
Pmt3)
was amplified from a cDNA library (Fikes
et al., 1990
) using primers pmt3-1 5'
CTGAGAACATATGTCTGAATCACC 3' and pmt3-4 5' TGGAGAGGATCCACGTATTGG
3' and cloned into the E. coli expression vector pET15b
(Novagen) and expressed as a 6xHis fusion in E. coli BL21
cells. Pmt3 protein was purified using Ni2+ agarose affinity
chromatography and used for polyclonal antisera production in rabbits (as
described in (Ho et al.,
2001
). Anti-myc antibodies were purified from cell supernatant
(cell line CRL1729, from ATCC) using protein G-sepharose. Anti-HA antisera
were from Babco, anti-tubulin antisera were from Sigma and anti-His antisera
were from Pharmacia.
Western blotting was carried out as described
(Harlow and Lane, 1988
) on
whole cell yeast lysates prepared by lysis in 150 mM NaCl, 10 mM
NaPO4 pH 7.0, 1 mM DTT or on TCA extracts of whole cells prepared
as described in Caspari et al. (Caspari et
al., 2000
). Immunofluorescence was carried out as described in
Moreno et al. (Moreno et al.,
1991
) using formaldehyde fixation.
Analysis of DNA damage responses
UV irradiation was carried out on freshly plated cells using a Stratagene
`Stratalinker'. Gamma irradiation was carried out using a [137Cs]
gamma source with a dose rate of 12 Gy/min. Sensitivity to hydroxyurea (HU)
was tested in liquid cultures at HU concentrations of 20 mM.
| Results |
|---|
|
|
|---|
|
Ulp1 processes the C terminus of Pmt3 precursor
Like ubiquitin and other Ubls, SUMO is produced as a precursor molecule,
which requires C-terminal processing involving the removal of a few amino
acids at the C terminus to reveal the double glycine (GG) motif required for
conjugation to an internal lysine residue of the substrate. In the case of
Pmt3, the equivalent processing reaction would be expected to remove six amino
acids (CTHLCL) to produce the mature form. To determine whether Ulp1 functions
in the processing of Pmt3 in S. pombe, we analysed the ability of
Ulp1 to process the Pmt3 precursor protein to its mature form. We expressed
the full-length [35S]methionine-labelled precursor form of Pmt3 in
vitro and incubated it with recombinant Ulp1 produced in E. coli or
with an equal volume of an equivalent fraction of an extract of E.
coli BL21 cells transformed with empty vector. Products were analysed by
SDS PAGE and compared with a truncated version of Pmt3 (Pmt3-GG) synthesised
in vitro, which lacks the last six amino acids. The results of the cleavage
assay verify that Ulp1 is proficient in the hydrolysis of Pmt3 in vitro
(Fig. 1B, lanes 1-3). The
processed product produced by Ulp1 (lane 3) migrates with a mobility identical
to that of the synthetic, truncated Pmt3-GG (lane 2). No processing is
observed in the negative control (lane 10). To ensure that the processing
observed in lane 3 was not due to an activity in the reticulocyte lysate used
to prepare the Pmt3 substrate, we assayed Ulp1 on full-length Pmt3 purified
from E. coli (lane 13). Comparison with the full-length Pmt3 and
Pmt3-GG controls (lanes 11 and 12 respectively) indicates that Pmt3 purified
from E. coli is also processed. The processed product is identical in
size to that observed following processing of Pmt3 produced in reticulocyte
lysate (lane 3). These data implicate Ulp1 as a Pmt3 protease in fission
yeast.
Sequence analysis indicates that S. pombe Ulp1 is a member of a
family of cysteine proteases. Other members of this family, for example,
S. cerevisiae Ulp1 (Li and
Hochstrasser, 1999
; Li and
Hochstrasser, 2000
), have been shown to be inhibited by N-ethyl
maleimide (NEM) and iodoacetamide. We wished to determine whether the
Pmt3-processing activity of Ulp1 was also affected by these inhibitors or by
any other protease inhibitors used in the preparation of S. pombe
cell extracts. Of the inhibitors we tested, only iodoacetamide (10 mM) and NEM
(10 mM) inhibited Ulp1 activity (Fig.
1B, lanes 7 and 8 respectively). The mammalian and yeast protease
inhibitor cocktails, benzamidine and PMSF, had no effect on processing
(Fig. 1B, lanes 4-6 and 9).
Similar results were obtained using Pmt3 purified following over-expression in
E. coli (data not shown).
Ulp1 can release Pmt3 from conjugates in S. pombe
extracts
We next asked if Ulp1 is also involved in deconjugation of Pmt3 from
modified substrates. In freshly prepared S. pombe cell extracts of
cells grown in rich medium to around 106 cells/ml (early-mid
exponential phase), the majority of Pmt3 cross-reacting material is of
Mr greater than 100 kDa, and unconjugated Pmt3 monomer is
not detected (Fig. 2A, lane 1).
We therefore used such extracts to assay Ulp1 protein for its ability to
cleave Pmt3 conjugates as this would allow us to observe the release of Pmt3
from high molecular weight species. Incubation of cell extracts with Ulp1
results in the appearance of free, unconjugated Pmt3
(Fig. 2A, lanes 3-6), and this
is dependent on the presence of added Ulp1 as incubation of the extracts in
the absence of Ulp1 does not release the Pmt3 monomer
(Fig. 2A, lane 2).
Deconjugation of Pmt3 from high Mr species was not
observed following incubation of extracts with 2 µl of the Talon column
fraction equivalent to that containing the Ulp1 protein but prepared from
E. coli cells transformed with empty vector (data not shown). These
data indicate that Ulp1 is capable of releasing Pmt3 from high
Mr conjugates. Interestingly, some high molecular weight
species that cross-react with anti-Pmt3 antisera remain even when the period
of incubation is increased to 40 minutes
(Fig. 2A lanes 4-6). The nature
of these high Mr species is unknown, but may represent
Pmt3-modified targets that are not affected by Ulp1 protease activity. If this
is the case, Ulp1 may not be the only protease involved in the Pmt3
decongugation pathway in fission yeast.
|
The two cysteine protease inhibitors, iodoacetamide and NEM, which inhibit the Pmt3-processing activity of Ulp1, and the serine protease inhibitor PMSF, have no effect on Pmt3 deconjugating activity (Fig. 2B, lanes 4-6) even using concentrations of NEM as high as 100 mM or a combination of 10 mM or 20 mM each of NEM and iodoacetamide (data not shown). To ensure that the lack of inhibition was not due to quenching of the inhibitors in the yeast cell extract, Ulp1 protein was pre-incubated in the presence of 100 mM iodoacetamide, 100 mM NEM or 5 mM PMSF before being added to the cell extract. Pre-incubation of Ulp1 had no effect on the deconjugating activity of Ulp1 (Fig. 2B, lanes 7-9).
Ulp1-null cells display aberrant cell and nuclear morphologies
We next disrupted the genomic copy of ulp1 to determine whether
the ulp1 gene is essential for cell viability
(Fig. 3A). Tetrad analysis of
the heterozygous ulp1+/ulp1-diploid initially
suggested that ulp1 was essential as no ura+
colonies were obtained from 20 dissected tetrads. In parallel we also
undertook random spore analysis in case germination of
ulp1- spores was a rare event. Ten days after plating
spores from the ulp1+/ulp1- heterozygote, very
small colonies were obtained on YES medium that were subsequently shown to be
ura+, whereas the more abundant, larger colonies, which
appeared three days after plating on YES, were all found to be
ura- when tested on selective medium. Microscopic analysis
of the ura+ colonies indicates a range of cell and nuclear
abnormalities (Fig. 3B).
ulp1.d (ulp1-null) cells are generally elongated compared
with wild-type cells, and, in some cases the nucleus is displaced from the
expected position within the cell. Many ulp1-null cells have
irregular shapes, whereas others are multiply septated. The doubling time of
ulp1.d cells is around 5 hours compared with 2.5 hours for wild-type
cells. The ulp1.d phenotype is thus similar to the phenotypes of
rad31.d and hus5.62, which are defective in one subunit of
the Pmt3 activator and the Pmt3 conjugator, respectively
(al-Khodairy et al., 1995
;
Shayeghi et al., 1997
).
|
The rad31 and hus5 genes are required for the DNA damage
response, as the rad31.d and hus5.62 strains are sensitive
to UV and ionising radiation and the DNA synthesis inhibitor HU
(al-Khodairy et al., 1995
;
Shayeghi et al., 1997
).
Fig. 3C-E show that
ulp1-null cells are also sensitive to DNA damage and HU. The level of
sensitivity to UV radiation is similar to that of rad31.d and
hus5.62 cells, but ulp1.d cells are less sensitive than
rad31.d and hus5.62 to ionising radiation and HU (for
example, rad31.d has an approximately 0.1% survival rate at 1000 Gy
compared with 3% for ulp1.d and a 10% survival rate in response to 8
hours incubation in the presence of HU as compared to 40% for ulp1.d)
(al-Khodairy et al., 1995
;
Shayeghi et al., 1997
). The
ulp1-null cells similar to rad31-null cells showed
hypersensitivity to 10 mM caffeine (data not shown), and the slow growth of
ulp1.d cells is partially rescued by growth on plates containing 1 M
sorbitol (data not shown).
The rad31.d and hus5.62 mutants are defective in a
pathway that also involves the DNA integrity checkpoint genes
(al-Khodairy et al., 1995
;
Shayeghi et al., 1997
), and
more specifically, hus5.62 is defective in the recovery from
checkpoint arrest. To determine whether ulp1 also functions in a
checkpoint-dependent process, a range of double mutants was made and analysed
for sensitivity to UV radiation. As shown in
Fig. 3F, the
ulp1.d,rad17.d double mutant displays no increase in sensitivity over
the rad17.d single mutant, indicating that ulp1 and
rad17 function in a common pathway. Similar results were obtained
with other checkpoint rad mutants (data not shown).
ulp1-null cells have reduced levels of Pmt3 conjugates that
are restored by over-expression of mature Pmt3
As we have shown that Ulp1 can remove Pmt3 from high molecular weight
conjugates in cell extracts (Fig.
2A), we wished to determine whether the ulp1-null allele
showed any difference in the pattern of Pmt3 conjugates when compared with
wild-type cells and if so, whether expression of mature Pmt3 had any effect on
the pattern of conjugates. Wild-type and ulp1-null cells were
transformed with pREP41HA-Pmt3, pREP41HA-Pmt3GG and the empty vector pREP41HA.
Transformed cells were grown in selective medium to mid-late exponential
phase, conditions where some unconjugated Pmt3 is observed in cells (unlike
the situation in cells grown to early exponential phase in rich medium when
free Pmt3 is not detected, (Fig.
2A, lane 1)). Western analysis using anti-Pmt3 antisera on
extracts from cells transformed with empty vector
(Fig. 4A) shows that the
ulp1-null strain has a reduced level of Pmt3 conjugates (lane 4)
compared with the level of conjugates observed in wild-type cells (lane 1).
(Similar results are obtained with untransformed cells, data not shown.) These
data suggest that the loss of Pmt3 processing activity in ulp1 null
cells is limiting the extent of Pmt3 conjugation to substrate proteins.
|
We next investigated whether it was possible to bypass the loss of Pmt3-processing activity in the ulp1-null cells by over-expressing mature Pmt3 (Pmt3-GG). Wild-type cells expressing either HA-Pmt3 or HA-Pmt3-GG show no major changes in the pattern of Pmt3 conjugates detected using anti-Pmt3 antisera when compared with extracts from cells transformed with the empty vector (Fig. 4A, lanes 1-3). Probing with anti-HA antisera indicates that HA-tagged species are equally abundant in wild-type cells transformed with either HA-Pmt3 or HA-Pmt3-GG, implying that both the precursor and mature forms of Pmt3 can be used for incorporation into high molecular weight conjugates (Fig. 4B, lanes 2 and 3). In contrast ulp1-null cells are less able than wild-type cells to incorporate HA-Pmt3 species when provided with HA-tagged precursor Pmt3 (Fig. 4A and B, lane 5). However ulp1-null cells use HA-Pmt3-GG efficiently, with the result that HA-tagged species are as abundant in ulp1.d + HA-Pmt3-GG (Fig. 4B, lane 6) as they are in the equivalent wild-type transformant (lane 3).
Fig. 4 confirms that ulp1-null cells are defective in the processing of precursor Pmt3 to the mature form. In this experiment, wild-type cells (Fig. 4A, lanes 1-3) accumulate an anti-Pmt3 cross-reacting species of approximately 22 kDa, representing Pmt3-GG (the mature form of Pmt3). Wild-type cells transformed with either HA-Pmt3 or HA-Pmt3-GG also accumulate another species of around 26 kDa, representing HA-Pmt3-GG (Fig. 4A and B, lanes 2 and 3). In contrast, the smallest anti-Pmt3 cross-reacting species observed in ulp1-null cells (lanes 4-6) is around 23 kDa, that is, about 1 kDa larger than the smallest species observed in wild-type cells (lanes 1-3) and consistent with the size expected for full-length Pmt3. Additionally, ulp1-null cells transformed with HA-Pmt3 (Fig. 4A and B, lane5) accumulate an anti-HA cross-reacting species slightly larger than the 26 kDa species observed in HA-Pmt3 transformed wild-type cells (Fig. 4A and B, lane 2), consistent with it being the HA-tagged form of full-length Pmt3. Fig. 4B, lane 6 indicates that very little HA-tagged Pmt3-GG monomer is present in ulp1.d cells transformed with HA-Pmt3GG, this is likely to be due to the fact that much of it is conjugated to targets in ulp1-null cells.
We were interested in determining whether expression of Pmt3-GG could rescue the slow growth phenotype or the UV radiation sensitivity of ulp1.d cells. Cells transformed with the appropriate plasmids were grown for 12 hours in selective liquid medium in the absence of thiamine to mid-log phase and then diluted to 106 cells/ml in fresh thiamine-free medium (time=0). The cell number was monitored every 2 hours for up to 12 hours. Over-expression of full-length or mature Pmt3 in wild-type cells has a deleterious effect on cell growth rate after 18-20 hours under de-repressing conditions (Fig. 4C). In contrast, over-expression of full-length or mature Pmt3 in ulp1.d cells is not deleterious and may provide a very slight increase in the rate of growth 18-20 hours after release into thiamine-free medium (Fig. 4D). However, any increase in the rate of cell division is short lived, and after 20-22 hours the rate resembles that of cells transformed with empty vector. Over-expression of full-length or mature Pmt3 has no effect on UV radiation survival rates for either wild-type (sp.01) or ulp1.d cells (Fig. 4E).
The level of Ulp1 protein is affected by increased temperatures but
not by exposure to HU or ionising radiation
To investigate Ulp1 protein expression in cells, we used a strain (sp.611)
containing a myc-epitope-tagged genomic copy of ulp1.
Fig. 5A (lane 1) shows that the
myc-tagged Ulp1 protein migrates as a doublet of Mr between 90-100 kDa. The
increased size observed here compared with the size of Ulp1 purified from
E. coli (Fig. 1A) is
accounted for by the presence of 13 myc tags (approximately 17.2 kDa). The
nature of the doublet is unknown but may reflect proteolysis of Ulp1, an
internal translation initiation site, post-translational processing or
alternative splicing.
|
The level of the Ulp1 protein does not change in cells exposed to 20 mM HU for 3 hours (Fig. 5A, lane 2) or in cells 1.5 hours after exposure to 500 Gy ionising radiation (lane 3). In contrast, the level of Ulp1 and the proportion of the upper and lower bands change in response to different temperatures. In cells grown at 25°C and then shifted to 30°C Fig. 5B (lane 2), the level of Ulp1 protein is similar to the level observed in cells maintained at 25°C (lane 1). However, when cells are incubated at 35.5°C for 3 hours (lane 3) the amount of the upper species decreases with a concomitant increase in the lower species and an overall reduction in the total amount of the protein.
Localisation of Ulp1 changes through the cell cycle
The two S. cerevisiae Smt3 proteases are differentially localised
within the cell (Li and Hochstrasser,
2000
; Schwienhorst et al.,
2000
). To identify the intracellular localisation of the S.
pombe Ulp1 protein, immunofluorescence analysis with anti-myc antisera
was undertaken using strain sp.611, which contains a myc-epitope-tagged
genomic copy of ulp1. Many cells in an exponentially growing culture
display strong staining at the nuclear periphery
(Fig. 6A) in a pattern similar
to that observed with S. cerevisiae Ulp1. However, we noticed that in
a significant proportion of cells this peripheral nuclear staining was not
evident. We therefore investigated whether the localisation of Ulp1 was cell
cycle dependent. The majority of cells (approximately 80%) in an exponentially
growing culture of wild-type S. pombe are in G2. In these cells, Ulp1
localises predominantly to the nuclear periphery
(Fig. 6Ba,b). As cells enter
mitosis (c,d), the staining remains strong, but becomes more diffuse in the
region of the nucleus. During anaphase (e-h) the intensity of the Ulp1
staining decreases as Ulp1 staining appears within the nucleus. The staining
within the nucleus persists as the spindle elongates (i-1) and is weak during
G1 (m-o). The Ulp1 staining at the nuclear periphery reappears at around the
time of septation (p,q), which is equivalent to S phase in S. pombe.
Throughout most stages of the cell cycle, weak punctate staining of Ulp1 is
also observed in the cytoplasm, for example,
Fig. 6A.
|
| Discussion |
|---|
|
|
|---|
In S. pombe, the Ulp1 protein migrates as a doublet. The doublet
is observed in TCA extracts of cells and in native cell extracts in the
presence of protease inhibitors, suggesting that it is not due to proteolysis.
It is also unlikely to be due to phosphorylation, as incubation with
protein phosphatase has no effect on the doublet (data not shown). We are
currently investigating whether the ulp1 mRNA is differentially
spliced and, if so, whether the different protein products have different
activities.
Deletion analysis indicates that ulp1 is not essential for
viability, in contrast to the situation in S. cerevisiae
(Li and Hochstrasser, 1999
).
The reason for this difference between the two yeasts is not known, but
SMT3, the S. cerevisiae SUMO gene, is essential for cell
viability whereas S. pombe pmt3 is not
(Tanaka et al., 1999
). The low
frequency of recovery of ulp1-null cells (approximately 1-2% of the
number of wild type cells obtained) might be due to poor spore germination in
ulp1-null cells. S. pombe ulp1-null cells isolated here
display severe cell and nuclear abnormalities. This is reminiscent of the
defects observed in rad31.d and hus5.62 cells, which have
mutations in other components of the sumoylation pathway. Crosses of
ulp1.d with rad31.d produced very few asci, with the result
that we have so far been unable to obtain a ulp1.d,rad31.d double
mutant to confirm genetically that the two genes function in the same
process(es). The range of phenotypes such as the sensitivity to UV radiation
and caffeine (a molecule likely to have a number of effects on the cell
including the ability to over-ride the S-M checkpoint
(Moser et al., 2000
)) and the
rescue by the osmotic stabiliser, sorbitol, displayed by ulp1.d,
rad31.d and hus5.62 implies that Pmt3 modification is likely to
have a number of functions within cells.
Over-expression of full-length or mature Pmt3 was unable to rescue the slow growth phenotype of ulp1.d cells. The reason for this is unknown, but since over-expression of Pmt3 or Pmt3-GG in wild-type cells is deleterious, the amount of Pmt3/Pmt3-GG in cells appears to be critical. The inability of increased levels of Pmt3-GG to rescue substantially the slow growth or UV-sensitive phenotypes of ulp1.d cells could be due to the requirement for the deconjugating activity of Ulp1, which is presumed to be still defective in these transformed cells. This would imply that there is/are Pmt3-modified target(s) with key roles in cell cycle progression and/or the DNA damage response that require Ulp1 for deconjugation.
In S. pombe, GFP-Pmt3 has been shown to be localised predominantly
within the nucleus and, more specifically, to associate with the SPB during
interphase (Tanaka et al.,
1999
). During prometaphase and metaphase, the Pmt3 staining at the
SPB disappears and cells in anaphase display weak Pmt3 staining between the
SPBs. After anaphase Pmt3 reappears at the SPBs. During S and G2, we detect
myc-tagged Ulp1 at the nuclear periphery consistent with data from S.
cerevisiae (Schwienhorst et al.,
2000
) where Ulp1 colocalises with the nuclear pore complex. Unlike
the case in S. cerevisiae, we observe the pattern of Ulp1 staining to
change as cells enter mitosis. The changes that we observe at the early stages
of mitosis coincide with the changes observed in Pmt3 localisation
(Tanaka et al., 1999
). The
pattern of Ulp1 staining in Fig.
6B(d) suggests that Ulp1 might be transiently located at the ends
of the spindle. As is observed with GFP-Pmt3
(Tanaka et al., 1999
),
myc-tagged Ulp1 appears to be localised in the DAPI-negative parts of the
nucleus during anaphase. (Fig.
6Be-l).
Data from work in Drosophila and mammalian cells have implicated
SUMO modification as having a role in the nuclear import of proteins (e.g.
Mahajan et al., 1998
;
Saitoh et al., 1998
). Thus the
function of Ulp1 at the nuclear periphery during S and G2 may be to provide
mature Pmt3, either as a result of processing or deconjugating Pmt3 from
target proteins and recycling it for subsequent conjugation to target proteins
destined for nuclear import. The relocation of Ulp1 during mitosis may be
responsible for the alteration of the Pmt3 modification state of proteins
required specifically for mitosis, the identity of which remain to be
determined. A critical role for Ulp1 at G2/M has been shown in S.
cerevisiae, where a temperature-sensitive mutant of ulp1 arrests
at G2/M at the restrictive temperature (Li
and Hochstrasser, 1999
).
An important group of proteins that undergo cell-cycle-dependent
sumoylation are the S. cerevisiae septins
(Johnson and Blobel, 1999
).
The septins, which are located at the mother/bud neck (where they are required
for cytokinesis) are maximally sumoylated during mitosis. At this time of the
cell cycle, SUMO (Smt3) is clearly visible in rings at the mother/bud neck.
These proteins might thus be candidate proteins affected by the activity of
Ulp1. However, a similar staining pattern for Pmt3 during cytokinesis in
S. pombe has not been reported (e.g.
Tanaka et al., 1999
),
suggesting that the septins may not be major SUMO-modified targets in S.
pombe.
Another possible target is the centromere protein CENP-C, as
temperature-sensitive mutations in CENP-C have been shown to be suppressed by
over-expression of SUMO (Fukagawa et al.,
2001
; Meluh and Koshland,
1995
). The S. cerevisiae CENP-C homologue MIF2
has been shown to be required for maintaining the integrity of the mitotic
spindle during anaphase (Brown et al.,
1993
), and recently, a temperature-sensitive CENP-C mutant in
vertebrate cells has been shown to display metaphase delay and chromosome
missegregation (Fukagawa et al.,
2001
).
One of our aims is to identify S. pombe proteins modified by Pmt3.
As SUMO conjugates are unstable and/or present at low levels in cells (e.g.
Gostissa et al., 1999
) we
wished to determine whether it was possible to stabilise them by inhibiting
the deconjugating activity of Pmt3-specific proteases, such as Ulp1. However,
despite using high concentrations of known cysteine protease inhibitors we
were unable to inhibit deconjugation of Pmt3 from high molecular weight
species using either NEM or iodoacetamide. Another possible method for
stabilising Pmt3-modified species in order to facilitate their identification
might be to deplete the deconjugating enzymes. We are currently analysing
Pmt3-modified species present in ulp1.d cells where the processing
defect is rescued by the over-expression of HA-Pmt3-GG.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
al-Khodairy, F., Enoch, T., Hagan, I. M. and Carr, A. M. (1995). The Schizosaccharomyces pombe hus5 gene encodes a ubiquitin conjugating enzyme required for normal mitosis. J. Cell Sci. 108,475 -486.[Abstract]
Bahler, J., Wu, J. Q., Longtine, M. S., Shah, N. G., McKenzie, A., 3rd, Steever, A. B., Wach, A., Philippsen, P. and Pringle, J. R. (1998). Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe.Yeast 14,943 -951.[Medline]
Basi, G., Schmid, E. and Maundrell, K. (1993). TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene 123,131 -136.[Medline]
Boddy, M. N., Howe, K., Etkin, L. D., Solomon, E. and Freemont, P. S. (1996). PIC 1, a novel ubiquitin-like protein which interacts with the PML component of a multiprotein complex that is disrupted in acute promyelocytic leukaemia. Oncogene 13,971 -982.[Medline]
Brown, M. T., Goetsch, L. and Hartwell, L. H.
(1993). MIF2 is required for mitotic spindle integrity during
anaphase spindle elongation in Saccharomyces cerevisiae. J. Cell
Biol. 123,387
-403.
Carr, A. M., Schmidt, H., Kirchhoff, S., Muriel, W. J.,
Sheldrick, K. S., Griffiths, D. J., Basmacioglu, C. N., Subramani, S., Clegg,
M., Nasim, A. et al. (1994). The rad16 gene of
Schizosaccharomyces pombe: a homolog of the RAD1 gene of
Saccharomyces cerevisiae. Mol. Cell Biol.
14,2029
-2040.
Caspari, T. and Carr, A. M. (1999). DNA structure checkpoint pathways in Schizosaccharomyces pombe.Biochimie 81,173 -181.[Medline]
Caspari, T., Dahlen, M., Kanter-Smoler, G., Lindsay, H. D.,
Hofmann, K., Papadimitriou, K., Sunnerhagen, P. and Carr, A. M.
(2000). Characterization of Schizosaccharomyces pombe
Hus1: a PCNA-related protein that associates with Rad1 and Rad9.
Mol. Cell. Biol. 20,1254
-1262.
Craven, R. A., Griffiths, D. J., Sheldrick, K. S., Randall, R. E., Hagan, I. M. and Carr, A. M. (1998). Vectors for the expression of tagged proteins in Schizosaccharomyces pombe.Gene 221,59 -68.[Medline]
Desterro, J. M., Thomson, J. and Hay, R. T. (1997). Ubch9 conjugates SUMO but not ubiquitin. FEBS Lett. 417,297 -300.[Medline]
Desterro, J. M., Rodriguez, M. S. and Hay, R. T. (1998). SUMO modification of IkappaBalpha inhibits NF-kappaB activation. Mol. Cell 2,233 -239.[Medline]
Fikes, J. D., Becker, D. M., Winston, F. and Guarente, L. (1990). Striking conservation of TFIID in Schizosaccharomyces pombe and Saccharomyces cerevisiae. Nature 346,291 -294.[Medline]
Fukagawa, T., Regnier, V. and Ikemura, T.
(2001). Creation and characterization of temperature-sensitive
CENP-C mutants in vertebrate cells. Nucleic Acids Res.
29,3796
-3803.
Gong, L., Millas, S., Maul, G. G. and Yeh, E. T.
(2000). Differential regulation of sentrinized proteins by a
novel sentrin-specific protease. J. Biol. Chem.
275,3355
-3359.
Gostissa, M., Hengstermann, A., Fogal, V., Sandy, P., Schwarz, S. E., Scheffner, M. and Del Sal, G. (1999). Activation of p53 by conjugation to the ubiquitin-like protein SUMO. EMBO J 18,6462 -6471.[Medline]
Harlow, E. and Lane, D. (1988). Antibodies: a Laboratory Manual. New York: Cold Spring Harbor Laboratory Press.
Ho, J. C., Warr, N. J., Shimizu, H. and Watts, F. Z.
(2001). SUMO modification of Rad22, the Schizosaccharomyces
pombe homologue of the recombination protein Rad52. Nucleic
Acids Res. 29,4179
-4186.
Johnson, E. S. and Blobel, G. (1997). Ubc9p is
the conjugating enzyme for the ubiquitin-like protein Smt3p. J.
Biol. Chem. 272,26799
-26802.
Johnson, E. S. and Blobel, G. (1999). Cell
cycle-regulated attachment of the ubiquitin-related protein SUMO to the yeast
septins. J. Cell Biol.
147,981
-994.
Johnson, E. S., Schwienhorst, I., Dohmen, R. J. and Blobel, G. (1997). The ubiquitin-like protein Smt3p is activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer. EMBO J. 16,5509 -5519.[Medline]
Kim, K. I., Baek, S. H., Jeon, Y. J., Nishimori, S., Suzuki, T.,
Uchida, S., Shimbara, N., Saitoh, H., Tanaka, K. and Chung, C. H.
(2000). A new SUMO-specific protease, SUSP1, that is highly
expressed in reproductive organs. J. Biol. Chem.
275,14102
-14106.
Li, S. J. and Hochstrasser, M. (1999). A new protease required for cell-cycle progression in yeast. Nature 398,246 -251.[Medline]
Li, S. J. and Hochstrasser, M. (2000). The
yeast ULP2 (SMT4) gene encodes a novel protease specific for the
ubiquitin-like Smt3 protein. Mol. Cell. Biol.
20,2367
-2377.
Mahajan, R., Delphin, C., Guan, T., Gerace, L. and Melchior, F. (1997). A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 88,97 -107.[Medline]
Mahajan, R., Gerace, L. and Melchior, F.
(1998). Molecular characterization of the SUMO modification of
RanGAP1 and its role in nuclear envelope association. J. Cell
Biol. 140,259
-270.
Matunis, M. J., Wu, J. and Blobel, G. (1998).
SUMO modification and its role in targeting the Ran GTPase-activating protein,
RanGAP1, to the nuclear pore complex. J. Cell Biol.
140,499
-509.
Meluh, P. B. and Koshland, D. (1995). Evidence that the MIF2 gene of Saccharomyces cerevisiae encodes a centromere protein with homology to the mammalian centromere protein CENP-C. Mol. Biol. Cell 6,793 -807.[Abstract]
Moreno, S., Klar, A. and Nurse, P. (1991). Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.Methods Enzymol. 194,795 -823.[Medline]
Moser, B. A., Brondello, J. M., Baber-Furnari, B. and Russell,
P. (2000). Mechanism of caffeine-induced checkpoint override
in fission yeast. Mol. Cell. Biol.
20,4288
-4294.
Murray, J. M., Doe, C. L., Schenk, P., Carr, A. M., Lehmann, A.
R. and Watts, F. Z. (1992). Cloning and characterisation of
the S. pombe rad15 gene, a homologue to the S. cerevisiae
RAD3 and human ERCC2 genes. Nucleic Acids
Res. 20,2673
-2678.
Nishida, T., Tanaka, H. and Yasuda, H. (2000). A novel mammalian Smt3-specific isopeptidase 1 (SMT3IP1) localized in the nucleolus at interphase. Eur. J. Biochem. 267,6423 -6427.[Medline]
Rodriguez, M. S., Desterro, J. M., Lain, S., Midgley, C. A., Lane, D. P. and Hay, R. T. (1999). SUMO modification activates the transcriptional response of p53. EMBO J. 18,6455 -6461.[Medline]
Saitoh, H., Sparrow, D. B., Shiomi, T., Pu, R. T., Nishimoto, T., Mohun, T. J. and Dasso, M. (1998). Ubc9p and the conjugation of SUMO to RanGAP1 and RanBP2. Curr. Biol. 8, 121-124.[Medline]
Schwienhorst, I., Johnson, E. S. and Dohmen, R. J. (2000). SUMO conjugation and deconjugation. Mol. Gen. Genet. 263,771 -786.[Medline]
Shayeghi, M., Doe, C. L., Tavassoli, M. and Watts, F. Z.
(1997). Characterisation of Schizosaccharomyces pombe
rad31, a UBA-related gene required for DNA damage tolerance.
Nucleic Acids Res. 25,1162
-1169.
Sternsdorf, T., Jensen, K. and Will, H. (1997).
Evidence for covalent modification of the nuclear dot-associated proteins PML
and Sp100 by PIC1/SUMO. J. Cell Biol.
139,1621
-1634.
Tanaka, K., Nishide, J., Okazaki, K., Kato, H., Niwa, O.,
Nakagawa, T., Matsuda, H., Kawamukai, M. and Murakami, Y.
(1999). Characterization of a fission yeast SUMO homologue,
pmt3p, required for multiple nuclear events, including the control of telomere
length and chromosome segregation. Mol. Cell. Biol.
19,8660
-8672.
Tavassoli, M., Shayeghi, M., Nasim, A. and Watts, F. Z.
(1995). Cloning and characterisation of the
Schizosaccharomyces pombe rad32 gene: a gene required for repair of
double strand breaks and recombination. Nucleic Acids
Res. 23,383
-388.
Yeh, E. T., Gong, L. and Kamitani, T. (2000). Ubiquitin-like proteins: new wines in new bottles. Gene 248,1 -14.[Medline]
This article has been cited by other articles:
![]() |
C.-H. Cheng, Y.-H. Lo, S.-S. Liang, S.-C. Ti, F.-M. Lin, C.-H. Yeh, H.-Y. Huang, and T.-F. Wang SUMO modifications control assembly of synaptonemal complex and polycomplex in meiosis of Saccharomyces cerevisiae Genes & Dev., August 1, 2006; 20(15): 2067 - 2081. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Di Bacco, J. Ouyang, H.-Y. Lee, A. Catic, H. Ploegh, and G. Gill The SUMO-Specific Protease SENP5 Is Required for Cell Division Mol. Cell. Biol., June 15, 2006; 26(12): 4489 - 4498. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Potts and H. Yu Human MMS21/NSE2 Is a SUMO Ligase Required for DNA Repair Mol. Cell. Biol., August 15, 2005; 25(16): 7021 - 7032. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gill SUMO and ubiquitin in the nucleus: different functions, similar mechanisms? Genes & Dev., September 1, 2004; 18(17): 2046 - 2059. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Soustelle, L. Vernis, K. Freon, A. Reynaud-Angelin, R. Chanet, F. Fabre, and M. Heude A New Saccharomyces cerevisiae Strain with a Mutant Smt3-Deconjugating Ulp1 Protein Is Affected in DNA Replication and Requires Srs2 and Homologous Recombination for Its Viability Mol. Cell. Biol., June 15, 2004; 24(12): 5130 - 5143. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bailey and P. O'Hare Characterization of the Localization and Proteolytic Activity of the SUMO-specific Protease, SENP1 J. Biol. Chem., January 2, 2004; 279(1): 692 - 703. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||