|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
1 Autoimmunity and Transplantation Division, The Walter and Eliza Hall Institute
of Medical Research, PO The Royal Melbourne Hospital, Parkville 3050,
Australia
2 Cancer Division, The Walter and Eliza Hall Institute of Medical Research, PO
The Royal Melbourne Hospital, Parkville 3050, Australia
Author for correspondence (e-mail: harrison{at}wehi.edu.au )
Accepted 1 November 2001
| Summary |
|---|
|
|
|---|
-amylase-positive cells. These findings
indicate that members of the TGF-ß superfamily regulate pancreas
epithelial cell development and can promote the formation of islet-like
structures in vitro.
Key words: Bone morphogenetic proteins, Pancreas, Epithelial colony, Fetus, Development, ß-cells
| Introduction |
|---|
|
|
|---|
Several soluble extracellular factors have been implicated in pancreatic
epithelial cell development, including members of the TGF-ß superfamily.
Transgenic mice expressing a dominant-negative TGF-ß receptor II
controlled by the mouse metallothionein 1 promoter display increased
proliferation and impaired differentiation of pancreatic acinar cells
(Bottinger et al., 1997
).
Transgenic mice expressing a dominant-negative activin receptor controlled by
the human insulin promoter have hypoplasia of pancreatic islets
(Yamaoka et al., 1998
). Hebrok
et al. (Hebrok et al., 1998
)
found that activin B is expressed in the notochord adjacent to the domain of
foregut endoderm from which the pancreatic primordia derives. Activin B
represses endodermal expression of sonic hedgehog - repression is a
pre-requisite for expression of the homeodomain transcription factor, Pdx-1,
which is required for pancreas development
(Jonsson et al., 1994
;
Offield et al., 1996
). The
bone morphogenetic proteins (BMPs), members of the TGF-ß superfamily,
have been shown to be important in the development of kidney tubule, lung and
other organ epithelia (Hogan,
1996a
; Weaver et al.,
1999
) and are expressed in the pancreas. BMP-7 was detected
immunocytochemically in human fetal pancreas duct epithelium
(Vukicevic et al., 1994
) and
by mRNA in situ hybridization in mouse pancreas epithelium between embryonic
day (E) 12.5 and E14.5 (Lyons et al.,
1995
). These findings prompted us to investigate the effects of
TGF-ß superfamily members on fetal pancreas cells in vitro.
| Materials and Methods |
|---|
|
|
|---|
50,000 viable cells (48,509±11,299; n=14). Dissociated
cells were plated in 8-well chamber slides (Nunc, Naperville, USA) at
7.5x104 cells/well in 0.3 ml AIM V medium supplemented with
N-2 (1: 100, Gibco BRL Life Technologies, Gaithersburg, USA), 500 UI/ml
penicillin and 500 µg/ml streptomycin. Laminin-1 (160 µg/ml), purified
from murine Engelbreth-Holm-Swarm tumour basement membrane (Becton Dickinson
Labware, Bedford, USA), was overlayed on cells in the presence of various
commercially available growth factors. Cultures were incubated in 10%
CO2 90% air at 37°C, for up to 6 days. Recombinant human BMP-6
and BMP-5, members of the 60A subgroup, and BMP-4, a representative of the dpp
subgroup (Hogan, 1996b
Colony quantitation
Colony formation was assessed at day 6 of culture. A colony was defined as
a cellular sphere
30 µm in diameter that contained more than 20 cells.
The number of colonies per well was counted directly under an inverted
microscope at x10. Colony counts were performed using a blind
design.
Immunocytochemistry and histocytochemistry
Guinea pig anti-porcine insulin antiserum (final 1:200), rat monoclonal
anti-E-cadherin IgG2a (clone ECCD-2) (1:100) and rabbit antiserum to porcine
glucagon (1:100) and to human somatostatin (1:200) were purchased from Dako
(Glostrup, Denmark). Fractionated rabbit antiserum to human
-amylase, a
marker of acinar cells, was from Sigma. Mouse monoclonal anti-BrdU IgG2a
(Clone BU-1) was purchased from Amersham Pharmacia Biotech (Buckinghamshire,
UK).
After 6 days of culture, some pancreas cell colonies were washed with warm PBS, fixed in 4% paraformaldehyde (PFA) and stained for proinsulin, a marker of ß cells, with 0.5 µg/ml mouse anti-human IgG1 proinsulin monoclonal antibody (clone M32337, Fitzgerald Industries International Concord, MA). Anti-proinsulin antibody was used to avoid the non-specific staining seen with guinea pig anti-insulin serum under these conditions. The specificity of this antibody was demonstrated by the complete blocking of staining in the presence of 80 µg/ml recombinant mouse proinsulin. In order to study colony cells in more detail, colonies were harvested by digestion with dispase (Becton Dickinson, Labware). Following inactivation of dispase by addition of 8% BSA, the colonies were fixed in 4% PFA, embedded into 1% low melting point agarose gel and processed for histological sections (5 µm) using standard procedures. Sections were routinely stained for hematoxylin and eosin (H&E).
For immunoperoxidase staining, endogenous peroxidase was blocked by 3% H2O2 in methanol for 8 minutes. Before addition of antibody, non-specific protein binding was blocked by incubation of tissues for at least 30 minutes with PBS containing 2% BSA or 2% normal rabbit serum. Negative controls were performed by replacing the first antibody with pre-immune serum from the appropriate species or by isotype-matched control monoclonal antibody. Colony sections were incubated with primary antibodies for 90 minutes at 25°C, followed by three washes with PBS. Horseradish-peroxidase-conjugated rabbit anti-guinea pig, swine anti-rabbit and rabbit anti-mouse immunoglobulins (Dako) at 1:80 were added for 30 minutes at 25°C, followed by thorough washes. Immunoperoxidase was detected with 3,3'-diaminobenzidine/H2O2 for 4-8 minutes. Slides were counterstained with haematoxylin and examined and photomicrographed under an Olympus microscope.
For immunofluorescence staining, fluorescein-isothyocyanate-conjugated rabbit anti-mouse immunoglobulins (Dako) were added for 30 minutes at 25°C, followed by three thorough washes. Slides were observed and photomicrographed under a Zeis Axiophot fluorescent microscope.
The periodic acid Schiff (PAS) reaction
(Bancroft and Stevens, 1982
)
was used to stain basement membranes.
RT-PCR analysis of mRNA transcripts
Fetal pancreata were removed under a dissection microscope and snap-frozen
on dry ice. Total RNA was extracted with phenol/guanidine isothiocyanate-based
RNAzol B (Cinna/Biotex, Hoston, USA), treated with DNAse I and then reverse
transcribed with Superscript II reverse transcriptase (GibcoBRL) in 1x
transcription buffer containing 0.5 µM oligo(dT) 16-18 primer (GibcoBRL)
and 400 µM dNTPs. Aliquots of the cDNAs were amplified by PCR in
1xPCR buffer (Perkin, Elmer, USA) containing 200 µM dNTPs, 1 µM of
each primer pair, 1.5 mM Mg2+ and 1 U Taq polymerase. The following
primers were employed: BMP-2 (5' GGAAAAGGACATCCGCTCCACAAACG 3';
5' ATTTATTCTTGCTGTGCTAACGACAC 3', 404 bp), BMP-4 (5'
CAAACGTAGTCCCAAGCATCACCCAC 3'; 5' TCCGCCCTCCGGACTGCCTGATCTC
3', 453 bp), BMP-5 (5' GAGCACAGCAAGGCTTGGGAACATG 3';
5' GCTGGAGATTATAATACCAGTGAAC 3', 240bp), BMP-6 (5'
GTTCTTCAGACTACAACGGCAGTGAG 3'; 5' GTTAGGAATCCAAGGCAGAACCATG
3', 402bp), BMP-7 (5' GTGTGGCAGAAAACAGCAGCAGTGAC 3';
5' GACATCGAAGATTTGGAAAGGTGTG 3', 401bp), TGFß-1 (5'
ACCAACTATTGCTTCAGCTCCACAG 3'; 5' GCAGGAGCGCACAATCATGTTGGAC
3', 317bp), activin A (5' CTTGGAGTGCGACGGCAAGGTCAAC 3';
5' CATTTTCTCTGGGACCTGGCGACTC 3', 372 bp) and the `housekeeping'
gene ß actin (5' GTGGGCCGCCCTAGGCACCA 3'; 5'
CTCTTTGATGTCACGCACGATTTC 3', 530 bp). PCR reactions were performed for
35 cycles (94°C, 30 seconds; 55°C, 30 seconds; 72°C, 30 seconds)
and amplified products separated in 1.5% agarose gels.
Statistics
Multi-variable experiments were analysed by ANOVA and differences between
groups by the Student's t-test. Data are presented as
mean±s.d. of at least three experiments.
| Results |
|---|
|
|
|---|
|
TGF-ß superfamily members promote pancreatic epithelial cell
colony formation
Previously, we used a low cell density culture system to demonstrate that
fetal pancreas progenitor cells differentiate into insulin-positive ß
cells in the presence of laminin-1 (Jiang
et al., 1999
). When this system was modified by replacing
Hybridoma medium with AIM V medium supplemented with N-2, increasing the cell
density to 925 cells/mm2 and decreasing laminin-1 concentration
from 200 µg/ml to 160 µg/ml, a low frequency of cystic colonies was
observed (Fig. 2). These
conditions established a baseline on which the effects of other factors were
studied.
|
|
In a number of diverse developmental settings the activity of BMPs is opposed by other members of the TGF-ß superfamily, most notably by TGF-ß itself and activins. TGF-ß1 and activin A suppressed basal colony formation in the presence of laminin-1 alone (Fig. 4A), and antagonised BMP-6-promoted colony formation (P<0.01) (Fig. 4B). However, BMP-5 (100 ng/ml) did not antagonize BMP-6 (Fig. 4B). The dose-dependency of inhibition demonstrated that TGF-ß1 was 100-fold more potent than activin A (Fig. 4C). These results suggest that an interplay between TGF-ß1, activin and BMP signalling may be critical for pancreas epithelial cell development. Having established conditions that favour the formation of cystic colonies, we next examined the nature of the colonies themselves.
|
Colony generation involves cell proliferation
To determine whether the colonies contained proliferating cells, BrdU
labelling was performed during the last 16 hours of culture. Up to 10
BrdU-positive cells per colony were detected
(Fig. 5), providing evidence
that cellular proliferation contributed to colony formation.
|
Colonies originate from epithelial cells
Histology revealed the colonies to be duct-like structures containing
various forms of epithelial cells surrounding a central lumen
(Fig. 6). Some colonies were
composed predominantly of columnar epithelial cells
(Fig. 6B), others of cuboidal
cells (Fig. 6C), squamous
epithelial cells (Fig. 6D) or a
mixture of both columnar and squamous epithelial cells
(Fig. 6E). The majority of
colonies were surrounded by a PAS-positive basement membrane
(Fig. 6F). Colony cells
positively stained for E-cadherin, a specific epithelial cell marker involved
in cell-cell interactions (Fig.
6G), indicating that the colonies most probably originated from
ductal progenitor epithelial cells.
|
Colonies contain a low number of differentiated endocrine cells
Having identified colony cells as epithelial in nature, we then sought to
determine whether the colonies contained differentiated cell types or only
immature ductal epithelial cells. The majority of colony cells were negative
for all the differentiation markers examined. A few proinsulin-positive cells
only were detected (Fig. 7A).
When colony formation was suppressed by TGF-ß1, activin A or a higher
concentration of BMPs, more individual cells stained for proinsulin
(Fig. 7B). This is consistent
with our previous observation that ß-cell differentiation increased when
proliferation activity was inhibited
(Jiang et al., 2001
). In
sections of harvested colonies, a few insulin-positive cells were always
observed in the areas where cystic epithelial cells appeared to be
delaminating or segregating from the main body of the colony
(Fig. 7C-F). In addition, some
individual insulin-positive cells were also observed between colonies (not
shown). Glucagon-positive cells were also present in colonies, but were less
frequent than insulin-positive cells (Fig.
7G), and somatostatin-positive cells were not detected. Although
scattered
-amylase-positive cells were present, they were not present
within colonies (Fig. 7H).
|
| Discussion |
|---|
|
|
|---|
Laminin-1 allows pancreas cell development in vitro
Pancreas duct and islet cells have previously been shown to be capabel of
forming cystic structures when cultured with ECM molecules. Adult human
pancreas islet cells, for example, were found to `dedifferentiate' into ductal
epithelial cells and form cystic structures when cultured in collagen I gel
(Kerr-Conte et al., 1996
;
Yuan et al., 1996
). These
cells proliferated in a 3D culture, especially in the presence of Matrigel
(Kerr-Conte et al., 1996
). In
addition, isolated human pancreas duct cells cultured with Matrigel overlay
were also shown to form ductal cysts
(Bonner-Weir et al., 2000
).
However, because Matrigel contains a number of ECM proteins and growth factors
(McGuire and Seeds, 1989
) it
is difficult to identify the contribution made by individual molecules. We
circumvented this by using purified laminin-1 to establish a baseline from
which to study the effect of specific extrinsic factors on pancreatic cell
lineage development. The ability of fetal pancreas progenitor cells to
proliferate, differentiate and form cystic epithelial colonies in vitro
suggests that our culture system partially recapitulates development in vivo.
Moreover, the endpoint of this culture system, the formation of cystic
epithelial colonies containing differentiated endocrine cells, allowed us to
quantify the effect of alterations in the culture parameters. It will also be
of great interest to see if the nature and frequency of the various
differentiated cell types present in these cultures can be influenced by other
extrinsic factors.
TGF-ß superfamily members regulate pancreas cell lineage
development
Gene expression of some TGF-ß superfamily members has been detected
during pancreas development. In situ hybridization studies showed that BMP-7,
but not BMP-2, is expressed in mouse pancreas epithelium between E12.5 and
E14.5 (Lyons et al., 1995
).
Similarly, TGF-ß1 was strongly expressed in developing mouse pancreas
epithelial cells and eventually in acinar cells
(Crisera et al., 2000
). Our
RT-PCR data were broadly consistent with these results. Although activin was
immunocytochemically detected in the E12.5 mouse pancreas epithelium and
restricted to developing islets at E18.5
(Maldonado et al., 2000
),
systematic studies of the cellular localization of TGF-ß superfamily
members by immunocytochemistry are restricted by a lack of reliable
antibodies. We showed that BMP-4, BMP-5 or BMP-6 promote and TGF-ß1 or
activin A inhibit colony formation, demonstrating that TGF-ß superfamily
members play an important role in pancreas cell lineage development.
The underlying mechanism by which these BMPs promote colony formation
remains to be determined. Laminin-1 may concentrate BMPs on the cell surface
for binding to their receptors, as reported for other ECMs
(Taipale and Keski-Oja, 1997
).
Alternatively, our results might indicate some form of cross-communication
between the laminin-1 and BMP receptor pathways in a similar manner to that
observed for integrins and other growth factor signalling pathways in primary
fibroblasts (Clark and Brugge,
1995
; Moro et al.,
1998
). In fetal pancreas cells, we found that laminin-1 interacts
with
6 integrin to transduce a proliferation signal via the
MAP kinase pathway and with
-dystroglycan to transduce a
survival/differentiation signal for insulin-positive cells
(Jiang et al., 2001
). It will
be important to determine how signalling by members of the TGF-ß
superfamily intersects with these pathways. However, it can not be ruled out
that another coordinating factor, secreted by non-epithelial cells,
participates in promoting epithelial precursor cells to produce colonies, as
reported for hepatic patterning from early foregut endoderm
(Duncan and Watt, 2001
;
Rossi et al., 2001
).
TGF-ß1 and activin A antagonize BMP-induced colony
formation
The ability of TGF-ß1 and activin A to antagonize BMP-induced colony
formation supports the notion that a balance between growth promotion and
inhibition signals by TGF-ß superfamily members fashions normal
development of pancreas cell lineages. The ability of TGF-ß1 and activin
to oppose the effects of BMPs has also been noted in other cell systems. For
example, BMP-7 stimulates, whereas TGF-ß1 inhibits, differentiation of
cultured fetal rat calvarial cells
(Cheifetz et al., 1996
). In the
osteoblast-like cell line ROS17/2.8 and in primary rat calvarial cells,
TGF-ß1 stimulates, whereas BMP-7 inhibits, the expression of Smad4
(Li et al., 1998
), a
transduction molecule shared by the activin, BMP and TGF-ß signalling
pathways (Massague and Chen,
2000
; Weinstein et al.,
2000
). An opposing effect of activin A on BMP-7-induced
differentiation was also observed in human embryonal carcinoma cells
(Piek et al., 1999
). Our
observation that activin A inhibits the formation of pancreatic cell colonies
is interesting in light of the report by Yamaoka et al. that showed that
pancreatic expression of a dominant-negative activin receptor type II resulted
in islet hypoplasia (Yamaoka et al.
1998
). This apparent discrepancy may simply reflect the complexity
of the associations that occur between the various activin and BMP receptors.
For example, complexes containing the activin receptor I and BMP receptor II
or activin receptor II and BMP receptor I are also able to bind to BMP-2, -4
and -7 (Yamashita et al.,
1995
). Thus, dominant-negative activin receptors may not only
block activin signalling, but also signalling by BMP-2, -4, -6 and -7
(Chang et al., 1997
;
Hemmati-Brivanlou and Thomsen,
1995
; Schulte-Merker et al.,
1994
).
In summary, we demonstrate that specific BMPs promote growth and differentiation of fetal pancreas epithelial cells into cystic colonies containing insulin-positive ß cells, an effect antagonised by two other members of the TGF-ß superfamily, TGF-ß1 and activin A. These findings may have implications for generating insulin-producing ß cells in vitro for the treatment of type 1 diabetes.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bancroft, J. D. and Stevens, A. (1982). Carbohydrates. In Theory and Practice of Histological Techniques, pp. 188-190. Edinburgh: Churchill Livingstone.
Bonner-Weir, S., Taneja, M., Weir, G. C., Tatarkiewicz, K.,
Song, K. H., Sharma, A. and O'Neil, J. J. (2000). In vitro
cultivation of human islets from expanded ductal tissue. Proc.
Natl. Acad. Sci. USA 97,7999
-8004.
Bottinger, E. P., Jakubczak, J. L., Roberts, I. S., Mumy, M., Hemmati, P., Bagnall, K., Merlino, G. and Wakefield, L. M. (1997). Expression of a dominant-negative mutant TGF-beta type II receptor in transgenic mice reveals essential roles for TGF-beta in regulation of growth and differentiation in the exocrine pancreas. EMBO J. 16,2621 -2633.[Medline]
Chang, C., Wilson, P. A., Mathews, L. S. and Hemmati-Brivanlou, A. (1997). A Xenopus type I activin receptor mediates mesodermal but not neural specification during embryogenesis. Development 124,827 -837.[Abstract]
Cheifetz, S., Li, I. W., McCulloch, C. A., Sampath, K. and Sodek, J. (1996). Influence of osteogenic protein-1 (OP-1; BMP-7) and transforming growth factor-beta 1 on bone formation in vitro. Connect. Tissue Res. 35,71 -78.[Medline]
Clark, E. A. and Brugge, J. S. (1995).
Integrins and signal transduction pathways: the road taken.
Science 268,233
-239.
Crisera, C. A., Maldonado, T. S., Kadison, A. S., Li, M., Alkasab, S. L., Longaker, M. T. and Gittes, G. K. (2000). Transforming growth factor-beta 1 in the developing mouse pancreas: a potential regulator of exocrine differentiation. Differentiation 65,255 -259.[Medline]
Duncan, S. A. and Watt, A. J. (2001). BMPs on
the road to hepatogenesis. Genes Dev.
15,1879
-1884.
Hebrok, M., Kim, S. K. and Melton, D. A.
(1998). Notochord repression of endodermal Sonic hedgehog permits
pancreas development. Genes Dev.
12,1705
-1713.
Hemmati-Brivanlou, A. and Thomsen, G. H. (1995). Ventral mesodermal patterning in Xenopus embryos: expression patterns and activities of BMP-2 and BMP-4. Dev. Genet. 17,78 -89.[Medline]
Hogan, B. L. (1996a). Bone morphogenetic proteins in development. Curr. Opin. Genet. Dev. 6, 432-438.[Medline]
Hogan, B. L. (1996b). Bone morphogenetic
proteins: multifunctional regulators of vertebrate development.
Genes Dev. 10,1580
-1594.
Jiang, F. X., Cram, D. S., DeAizpurua, H. J. and Harrison, L. C. (1999). Laminin-1 promotes differentiation of fetal mouse pancreatic beta-cells. Diabetes 48,722 -730.[Abstract]
Jiang, F. X., Georges-Labouesse, E. and Harrison, L. C. (2001). Regulation of laminin 1-induced pancreatic beta-cell differentiation by alpha6 integrin and alpha-dystroglycan. Mol. Med. 7,107 -114.[Medline]
Jonsson, J., Carlsson, L., Edlund, T. and Edlund, H. (1994). Insulin-promoter-factor 1 is required for pancreas development in mice. Nature 371,606 -609.[Medline]
Kerr-Conte, J., Pattou, F., Lecomte-Houcke, M., Xia, Y., Boilly, B., Proye, C. and Lefebvre, J. (1996). Ductal cyst formation in collagen-embedded adult human islet preparations. A means to the reproduction of nesidioblastosis in vitro. Diabetes 45,1108 -1114.[Abstract]
Li, J., Tsuji, K., Komori, T., Miyazono, K., Wrana, J. L., Ito,
Y., Nifuji, A. and Noda, M. (1998). Smad2 overexpression
enhances Smad4 gene expression and suppresses CBFA1 gene expression in
osteoblastic osteosarcoma ROS17/2.8 cells and primary rat calvaria cells.
J. Biol. Chem. 273,31009
-31015.
Lyons, K. M., Hogan, B. L. and Robertson, E. J. (1995). Colocalization of BMP 7 and BMP 2 RNAs suggests that these factors cooperatively mediate tissue interactions during murine development. Mech. Dev. 50, 71-83.[Medline]
Maldonado, T. S., Kadison, A. S., Crisera, C. A., Grau, J. B., Alkasab, S. L., Longaker, M. T. and Gittes, G. K. (2000). Ontogeny of activin B and follistatin in developing embryonic mouse pancreas: implications for lineage selection. J. Gastrointest. Surg. 4,269 -275.[Medline]
Massague, J. and Chen, Y. G. (2000).
Controlling TGF-beta signaling. Genes Dev.
14,627
-644.
McGuire, P. G. and Seeds, N. W. (1989). The interaction of plasminogen activator with a reconstituted basement membrane matrix and extracellular macromolecules produced by cultured epithelial cells. J. Cell Biochem. 40,215 -227.[Medline]
Moro, L., Venturino, M., Bozzo, C., Silengo, L., Altruda, F., Beguinot, L., Tarone, G. and Defilippi, P. (1998). Integrins induce activation of EGF receptor: role in MAP kinase induction and adhesion-dependent cell survival. EMBO J. 17,6622 -6632.[Medline]
Offield, M. F., Jetton, T. L., Labosky, P. A., Ray, M., Stein, R. W., Magnuson, M. A., Hogan, B. L. and Wright, C. V. (1996). PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122,983 -995.[Abstract]
Piek, E., Afrakhte, M., Sampath, K., van Zoelen, E. J., Heldin, C. H. and ten Dijke, P. (1999). Functional antagonism between activin and osteogenic protein-1 in human embryonal carcinoma cells. J. Cell Physiol. 180,141 -149.[Medline]
Rossi, J. M., Dunn, N. R., Hogan, B. L. and Zaret, K. S.
(2001). Distinct mesodermal signals, including BMPs from the
septum transversum mesenchyme, are required in combination for hepatogenesis
from the endoderm. Genes Dev.
15,1998
-2009.
Schulte-Merker, S., Smith, J. C. and Dale, L. (1994). Effects of truncated activin and FGF receptors and of follistatin on the inducing activities of BVg1 and activin: does activin play a role in mesoderm induction? EMBO J. 13,3533 -3541.[Medline]
Taipale, J. and Keski-Oja, J. (1997). Growth factors in the extracellular matrix. FASEB J. 11, 51-59.[Abstract]
Vukicevic, S., Latin, V., Chen, P., Batorsky, R., Reddi, A. H. and Sampath, T. K. (1994). Localization of osteogenic protein-1 (bone morphogenetic protein-7) during human embryonic development: high affinity binding to basement membranes. Biochem. Biophys. Res. Commun. 198,693 -700.[Medline]
Weaver, M., Yingling, J. M., Dunn, N. R., Bellusci, S. and Hogan, B. L. (1999). Bmp signaling regulates proximal-distal differentiation of endoderm in mouse lung development. Development 126,4005 -4015.[Abstract]
Weinstein, M., Yang, X. and Deng, C. (2000). Functions of mammalian Smad genes as revealed by targeted gene disruption in mice. Cytokine Growth Factor Rev. 11, 49-58.[Medline]
Yamaoka, T., Idehara, C., Yano, M., Matsushita, T., Yamada, T., Ii, S., Moritani, M., Hata, J., Sugino, H., Noji, S. et al. (1998). Hypoplasia of pancreatic islets in transgenic mice expressing activin receptor mutants. J. Clin. Invest. 102,294 -301.[Medline]
Yamashita, H., ten Dijke, P., Huylebroeck, D., Sampath, T. K.,
Andries, M., Smith, J. C., Heldin, C. H. and Miyazono, K.
(1995). Osteogenic protein-1 binds to activin type II receptors
and induces certain activin-like effects. J. Cell
Biol. 130,217
-226.
Yuan, S., Rosenberg, L., Paraskevas, S., Agapitos, D. and Duguid, W. P. (1996). Transdifferentiation of human islets to pancreatic ductal cells in collagen matrix culture. Differentiation 61,67 -75.[Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||