spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

doi: 10.1242/10.1242/jcs.00169


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Corcoran, J.
Right arrow Articles by Maden, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corcoran, J.
Right arrow Articles by Maden, M.
Journal of Cell Science 115, 4735-4741 (2002)
Copyright © 2002 The Company of Biologists Limited
doi: 10.1242/jcs.00169


Research Article

Absence of retinoids can induce motoneuron disease in the adult rat and a retinoid defect is present in motoneuron disease patients

Jonathan Corcoran*,{ddagger}, Po Lin So and Malcolm Maden

MRC Centre for Developmental Neurobiology, New Hunt's House, King's College London, Guy's Campus, London SE1 1UL, UK
* Present address: Wolfson Centre for Age-Related Diseases, King's College London, Guy's Campus, London SE1 1UL, UK

{ddagger} Author for correspondence (e-mail: jonathan.corcoran{at}kcl.ac.uk)

Accepted 12 September 2002


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We generated retinoid-deficient adult rats by the removal of retinoids from their diet. We show that their motoneurons undergo neurodegeneration and that there is an accumulation of neurofilaments and an increase in astrocytosis, which is associated with motoneuron disease. These effects are mediated through the retinoic acid receptor {alpha}. The same receptor deficit is found in motoneurons from patients suffering from spontaneous amyotrophic lateral sclerosis. Furthermore, we show that there is a loss of expression of the retinaldehyde dehydrogenase enzyme II in motoneurons. Therefore, we propose that a defect in the retinoid signalling pathway is in part be responsible for some types of motoneuron disease.

Key words: Motoneuron, Retinoic acid, Neurodegeneration


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease characterized by the loss of motoneurons in the motor cortex, brain stem and spinal cord, which leads to weakness and atrophy (Delisle and Carpenter, 1984Go; Mulder et al., 1986Go). ALS occurs in both sporadic (90% of all cases) and familial forms (10% of all cases) (Jackson and Bryan, 1998Go). In 20% of familial ALS, mutations have been found in the Cu, Zn superoxide dismutase gene (SOD1) (Rosen, 1993Go; Deng et al., 1993Go). The genes involved in the sporadic cases have yet to be identified. However, since both the sporadic and familial forms are clinically similar this suggests that they both operate through the same pathways.

A feature of ALS is an abnormal accumulation of neurofilaments (NF) in the cell bodies and axons of motoneurons (Carpenter, 1968Go; Hirano et al., 1984aGo; Chou and Fakadej, 1971Go; Hirano et al., 1984bGo). NF are members of the family of intermediate filament proteins (IF). NF consist of three proteins known as light (NF-L, 68kDa), medium (NF-M, 95 kDa) and heavy (NF-M, 115 kDa). Overexpression of NF-L in mice results in degeneration and loss of motoneurons (Lee et al., 1994Go), and injection of NF protein into cultured neurons causes pathological changes that are observed in motoneuron disease (Straube-West et al., 1996Go). One other pathology that is associated with ALS is reactive astrocytosis. Astrocytes replicate and express increased amounts of glial fibrillary acidic protein (GFAP) in response to neuronal damage (Eddleston and Mucke, 1993Go; Montgomery, 1994Go).

One unexplored pathway through which ALS may occur is through a defect in the retinoid signalling pathway since retinoid-deficient diets can induce nerve lesions (Hughes et al., 1924Go; Irving and Richards, 1938Go). Retinoic acids (RAs) are synthesised in a two-step process. Firstly alcohol dehydrogenases act on retinols to synthesise retinals (Duester, 1998Go). RAs are then made from the retinals by retinaldehyde dehydrogenases (Raldhs). Three Raldhs have being identified that show a restricted tissue distribution in the embryo (Niederreither et al., 2002Go).

RA is important for the birth, survival and function of neurons (Wuarin and Sidell, 1991Go; Quinn and De Boni, 1991Go). RA can stimulate both neurite number and length (Maden, 1998Go; Corcoran and Maden, 1999Go; Corcoran et al., 2000Go). The LIM homeodomain gene islet-1 expressed by motoneurons can be regulated by RA, and raldh-2 is expressed by these neurons (Sockanathan and Jessell, 1998Go).

Cellular effects of RA are mediated by binding to ligand-activated nuclear transcription factors. There are two classes of receptors: RA receptors (RARs), which are activated both by all-trans-RA (tRA) and 9-cis-RA (9-cis-RA); and the retinoid X receptors (RXRs), which are activated only by 9-cis-RA (Kastner et al., 1994Go; Kliewer et al., 1994Go). There are three subtypes of each receptor: {alpha}, ß and {gamma}. In addition, there are multiple isoforms of each subtype owing to alternative splicing and differential promoter usage (Leid et al., 1992Go). RARs mediate gene expression by forming heterodimers with RXRs, whereas RXRs can mediate gene expression either as homodimers or by forming heterodimers with orphan receptors, which are also members of the nuclear receptor superfamily, examples of which include LXR and NGFI-B (Mangelsdorf and Evans, 1995Go).

In order to generate retinoid deficiency, the genes that encode the RA synthesising enzymes can be deleted. However, gene deletion of raldh-2 results in embryonic lethality (Niederreither et al., 1999Go); hence the effects of retinoids on motoneuron survival cannot be studied. Another approach is to create conditional mutants of raldh-2; however it cannot be guaranteed that raldh-2 can be deleted in all motoneurons in which it is expressed, thus raldh-2 expression may mask any phenotype. Since Raldh-2 requires substrates in order to make RA, an alternative approach is to deprive the adult of retinoids to prevent formation of RA, which, in effect, creates the equivalent of a conditional mutant. Thus Raldh-2 function is compromised in all cells that express it, including motoneurons, allowing its role to be assessed. Therefore, analogous to a gene deletion study, any phenotype observed must be a due to a lack of Raldh-2 function. We have generated adult retinoid-deficient rats by a dietary deficiency of retinoids and investigated whether there is an effect on their motoneurons. Our results support a role for the retinoid-signalling pathway in the survival of motoneurons, and a defect in this pathway leads to motoneuron disease in the adult rat. In patients suffering from spontaneous motoneuron disease, the retinoid signalling pathway was also found to be defective, suggesting that it may be one of the causes of the disease.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of retinoid-deficient adult rats and rotation behaviour
Once the rats (Wistar) were weaned they were fed on a normal diet (controls) or a commercially available vitamin-A-free diet (Special Diet Services) ad libidum. No other vitamins were absent from this diet. Animals were weighed every other day and a growth plateau was reached in both groups of rats after 4-5 weeks. After 6 months of constant monitoring and observation, a group of control (n=5) and A—rats (n=8) were killed by perfusion with 4% paraformaldehyde/0.5% glutaraldehyde and the tissues prepared for in situ hybridisation and immunocytochemistry. Another group of controls (n=5) and A— rats (n=8) was kept for 1 year and then killed. The number of rotations that the rats could perform was measured on a rotorod apparatus for 5 minutes. Immunohistochemistry and western blotting was carried out as previously described (Corcoran and Ferretti, 1999Go). The NF200 and GFAP antibodies were obtained from Sigma.

Human tissue
Post mortem lumbar spinal cord tissue was obtained from 10 cases of spontaneous motoneuron disease and 10 aged-matched controls. The tissue was fixed in 4% PFA, wax embedded and 10 µM sections were cut.

In situ hybridisation
In situ hybridisation was carried out as previously described (Corcoran et al., 2000Go). RNA-species-specific probes were generated from gene-specific PCR products. Every fifth slide containing two to three sections and five slides were analysed for each probe used.

Identification and counting of motoneurons
For both rats and humans, motoneurons were identified and counted as previously described (Sockanathan and Jessell, 1998Go). Spinal cord sections were examined at 100x magnification. Images of both left and right ventral horns where the motoneurons are located were captured and analysed by Image Pro Plus software. In order to count all the motoneurons, the motoneurons were selected on the basis of their size (35 µm in diameter and above) and automatically counted using the Image Pro Plus software. For in situ hybridisation analysis, motoneurons (35 µm in diameter and above) with a blue signal above background were selected as positive and automatically counted by Image Pro Plus software. In addition, for quantitative in situ hybridisation analysis the above-background digoxigenin signals of raldh-2, RAR{alpha} and islet-1 were measured in the motoneurons compared to the above-background digoxigenin signal of gapdh in motoneurons using the Image Pro Plus software. Sigma plot software was used for statistical analysis.

RT-PCR
RNA was extracted and reverse transcribed as previously described (Corcoran et al., 2000Go). Quantitative PCR was carried out using species-specific primers on a Roche Lightcycler. The primers used were human gapdh, forward 211 aagggtcatcatctctgcc 229, and reverse, 376 ttccacgataccaaagttgtc 356; human Raldh-2, forward 55 gttccctgtctataatccagcc 76, and reverse 204 gtcccctttctgaagcatc 185; human RAR{alpha}, forward 84 tctgagagctacacgctgac 103, and reverse 275 cttaatgatgcacttggtggag 254; human islet-1, forward 667 ggtctggtttcaaaacaagcg 687, and reverse 828 ttagcctgtaagccaccgtc 809. Cycling parameters were: denaturing 95°C, 1 second; annealing 55°C, 1 second; and extension 72°C 1 second for 30 cycles.


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
HPLC measurements were performed on the blood of all animals, the 6-month rats fed on the retinoid-deficient diet had little or no retinol, whereas the 1-year retinoid-deficient rats had no retinol compared to the normal fed rats (Fig. 1A,B). At 6 months, the retinoid-deficient rats could be distinguished from normally fed rats by their inability to extend their hindlimbs when held by the tail (Fig. 2A,B). In a rotorod test, the retinoid-deficient animals (n=5) were only able to perform 52% of the rotations compared to the normal fed rats (n=8), P<0.05 students t-test.



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 1. HPLC analysis of blood of rats. (A) 1-year-old normally fed rats; (B) 1-year-old retinoid-deficient rats. Arrows indicate retinol peak. The amount of retinol in the normally fed rat is 665 ng/ml blood; in the retinoid-deficient rat no retinol could be detected. Similar data were obtained from four other control rats and seven retinoid-deficient rats.

 


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 2. Effect of a retinoid-deficient diet on adult rats. (A) 6-month-old normally fed rat; (B) 6-month-old retinoid-deficient rat. Normal rats (A) extend their hindlimbs when they are held by the tail, whereas retinoid-deficient rats retract their hindlimbs. n=5-8.

 

Spinal cord sections were examined by staining for neuronal intermediate filaments with the antibody NF200 and the motoneurons identified by their location in the ventral horns. Neurofilaments had accumulated in the cell body of the motoneurons in the lumbar and cervical regions of retinoid-deficient spinal cords (Fig. 3B,D) compared to the same regions of the spinal cord of the normally fed rat (Fig. 3A,C). Also in the retinoid-deficient lumbar cord there was accumulation of the neurofilament in the axons (Fig. 3B). In the six-month-old retinoid-deficient rats, the motoneurons of the lumbar cord had more vacuolar lesions (Fig. 3B) than the motoneurons located in the cervical cord (Fig. 3D). In the normal rat no vacuolar lesions were seen in the motoneurons at either level of the spinal cord examined (Fig. 3A,C). There were 34% less motoneurons in the lumbar cord of the retinoid-deficient rats compared with the normally fed rats (Fig. 4 columns 1 and 2). Of the surviving motoneurons in the retinoid-deficient rat, 14% had vacuoles (Fig. 4 column 3). There was an increase in reactive astrocytosis in the lumbar cord of the retinoid-deficient rats (Fig. 5B,C, lane 2) compared with the lumbar cord of the normal rat (Fig. 5A,C, lane 1). After 1 year of a retinoid-deficient diet there was a dramatic loss of NF200 expression in the cell bodies of the surviving motoneurons of the retinoid-deficient rat compared with the motoneurons of the normally fed rats (data not shown).



View larger version (132K):
[in this window]
[in a new window]
 
Fig. 3. Expression of NF200 in lumbar (A,B) and cervical cord (C,D). (A) Lumbar cord of a 6-month-old normally fed rat. (B) Lumbar cord of a 6-month-old retinoid-deficient rat. (C) Cervical cord of a 6-month-old normally fed rat. (D) Cervical cord of 6-month-old retinoid-deficient rat. Black arrows and arrowheads indicate motoneurons. The arrowheads indicate motoneurons with vacuolar lesions. The white arrow indicates accumulation of neurofilament in the axons. Similar data were obtained from four other normal fed rats and seven other retinoid-deficient rats.

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4. A graph showing the percentage loss of motoneurons in the lumbar cord of the retinoid-deficient rats compared with the normally fed rats. Columns: 1, normally fed rats; 2, retinoid-deficient rats; 3, motoneurons with vacuolations in the retinoid-deficient rat. Error bar=s.e.m. There was a significant difference between the percentage of motoneurons in the normal and retinoid-deficient rats of *P<0.01. Students t-test, n=5-8.

 


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 5. Reactive astrocytosis in the lumbar cord of 6-month-old rats. Expression of GFAP in astrocytes. (A) Normal lumbar cord; (B) retinoid-deficient lumbar cord; (C) western blot of lumbar cord of 6-month-old rats, lanes: 1, normal lumbar cord lane 2, retinoid-deficient lumbar cord. The arrow indicates a protein band of the correct size. Similar data were obtained from four other normally fed rats and seven other retinoid-deficient rats.

 

We next investigated which components of the retinoid signalling pathway were perturbed. In situ hybridisation with the three RARs, and three raldhs showed that only RAR{alpha} and raldh-2 were expressed in the motoneurons. Although RAR{alpha} was depleted in the motoneurons of the lumbar cord of the 6-month-old retinoid-deficient rats compared to the equivalent regions of the cord in the control rats (Fig. 6A,B,E, columns 1 and 2) raldh-2 did not vary between the normally fed and retinoid-deficient rats (Fig. 6C-E, columns 1 and 2). Similar results were obtained from the 6 month cervical cord and the 1 year cords of both normal and retinoid-deficient rats (data not shown). This suggests that although a loss in RAR{alpha} expression is due to a lack of retinoids, the enzyme that makes these retinoids is not itself regulated by RA in the motoneurons.



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 6. Expression of RAR{alpha} and raldh-2 in motoneurons of lumbar cord of the of 6-month-old adult rat. In situ hybridization of A, RAR{alpha} expression in motoneurons of normal fed rat; B, RAR{alpha} expression in motoneurons of retinoid deficient rat; C, raldh-2 expression in motoneurons of normal fed rat; D, raldh-2 expression in motoneurons of retinoid deficient rat; E, quantification of the in situ signals of RAR{alpha} (columns 1 and 2) and raldh-2 (columns 3 and 4) expression compared with gapdh in motoneurons. Columns: 1 and 3, normally fed rats; 2 and 4, retinoid-deficient rats. Error bar=s.e.m. There was a significant difference in RAR{alpha} expression *P<0.01 but not raldh-2 expression between normally fed and retinoid-deficient rats. Students t-test, n=5-8. Arrows indicate motoneurons.

 

We next analysed the components of the retinoid signalling pathway identified in the retinoid-deficient rats in post mortem lumbar spinal cord tissue from spontaneous cases of motoneuron disease. Using real time RT-PCR, we quantified the amount of RAR{alpha}, RA enzymes and islet-1 expression compared with gapdh in human lumbar spinal cord from motoneuron-diseased and normal patients. All three transcripts were depleted in the diseased compared with the normal cord: RAR{alpha}, 37%; Raldh-2, 22%; islet-1, 42%; P<0.01. In order to count the number of motoneurons expressing these transcripts and the level of their expression in situ hybridisation was performed using gene-species-specific probes (Fig. 7A-F). The percentage of motoneurons in control and diseased patients expressing islet-1 was 61% and 48%, respectively (Fig. 6, columns 1 and 2). There was a 37% loss of motoneurons expressing RAR{alpha} in patients suffering from the disease compared with normal samples (Fig. 8, columns 3 and 4). We finally asked if there was a defect in the expression of raldh-2. In the non-diseased patients 56% of the motoneurons expressed this enzyme (Fig. 8, column 5) compared with 16% of the motoneurons in the diseased patients (Fig. 8, column 6), suggesting a decrease in expression of the enzyme in the diseased state.



View larger version (175K):
[in this window]
[in a new window]
 
Fig. 7. Expression of islet-1 and components of the retinoid signalling pathway by in situ hybridisation in the lumbar cord of a normal (A,C,E) and an aged-matched patient suffering from spontaneous motoneuron disease (B,D,F). A,B, islet-1 expression; C,D, RAR{alpha} expression; E,F, raldh-2 expression. Arrows indicate motoneurons. The brown deposit is lipofuscin, which is expressed by aged neurons. This does not interfere with the quantitative analysis. The same data was obtained from nine other patients.

 


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 8. Graph showing the percentage of motoneurons in the lumbar cord expressing islet-1 and components of the retinoid signalling pathway in aged-matched normal and motoneuron disease patients. Columns: 1, islet-1-positive motoneurons in normal cord; 2, islet-1-positive motoneurons in diseased cord; 3, RAR{alpha}-positive motoneurons in normal cord; 4. RAR{alpha}-positive motoneurons in diseased cord; 5, raldh-2-positive motoneurons in normal cord; 6, raldh-2-positive motoneurons in diseased cord. Error bar=s.e.m. There was no significant difference between the percentage of islet-1 motoneurons in normal and diseased aged-matched samples (columns 1 and 2). There was a significant difference between the number of RAR{alpha}-positive motoneurons (columns 3 and 4) *P<0.01 and between the number of raldh-2-positive motoneurons (columns 5 and 6) **P<0.001 of normal and diseased aged-matched samples. Students t-test, n=10.

 

Lastly, we quantified the in situ hybridisation signal of the transcripts in the surviving motoneurons to answer the question of whether the retinoid-signalling pathway was depleted in them. Islet-1 expression was decreased by 56%, RAR{alpha} by 31% and raldh-2 by 49% in the diseased motoneurons compared with their expression in non-diseased motoneurons, P<0.05 (Fig. 9 columns 1-6).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 9. Quantification of in situ hybridisation of islet-1 and components of the retinoid signalling pathway in the motoneurons in aged-matched normal and motoneuron disease patients compared to gapdh. Columns: 1, islet-1 expression in motoneurons of normal cord; 2, islet-1 expression in motoneurons of diseased cord; 3, RAR{alpha} expression in motoneurons of normal cord; 4, RAR{alpha} expression in motoneurons of diseased cord; 5, raldh-2 expression in motoneurons of normal cord; 6, raldh-2 expression in motoneurons of diseased cord. Error bar=s.e.m. There was a significant difference between islet-1 expression (columns 1 and 2), RAR{alpha} expression (columns 3 and 4) and between raldh-2 expression (columns 5 and 6) *P<0.05 of normal and diseased aged matched samples. Students t-test, n=10.

 


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Neurodegeneration in the retinoid-deficient rat and motoneuron disease patients have a similar pathology
In the motoneurons of the adult retinoid-deficient rat, there was an accumulation of neurofilament, vacuolations of the motoneurons and an increase in astrocytosis, which are all phenotypes observed in both human sporadic (Carpenter, 1968Go; Hirano et al., 1984aGo) and SOD1-mediated familial ALS (Hirano et al., 1984bGo; Rouleau et al., 1996Go; Shibata et al., 1996Go). This suggests that the motoneurons in both the rat and the human disease undergo a similar mechanism of degeneration. These effects were not as dramatic in the cervical cord; this may be due to the fact that the animals were kept only until 1 year of age.

Disruption of the retinoid signalling pathway in the adult rat leads to a loss of motoneurons
The major retinoid signalling pathway defect in the retinoid deficient rat is the loss of RAR{alpha} expression in the motoneurons: no expression of either RARß or RAR{gamma} was detected by in situ analysis or RT-PCR. RA has been shown to regulate RAR{alpha} (Leroy et al., 1991Go) and appears to be critical for the survival of the motoneurons. The data presented here shows that the retinoid signalling pathway is critical for the survival of neurons of the adult CNS. This has been previously shown for the embryonic CNS, where in addition it is required for the differentiation of neurons (Wuarin and Sidell, 1991Go; Quinn and De Boni, 1991Go). Therefore, the role of the retinoid signalling pathway in neuron survival in the embryonic CNS is conserved in the adult CNS.

Motoneuron defects have not been reported in RAR{alpha}-null mutant mice but to our knowledge such analysis has not been carried out. However, one of the major problems with such studies has been the functional redundancy between the receptors, thus masking their potential role in development and as well as their functions in the adult. The approach we have taken to overcome such functional redundancy is to create retinoid-deficient animals by a dietary deficiency of retinoids. This has a distinct advantage over the RAR gene deletion studies because the receptors are normally expressed during development when the embryos receive adequate amounts of retinoids, hence development is not perturbed. However, once the animals are retinoid-deprived, only the retinoid signalling pathway that is normally expressed in cells is altered. At such a late developmental stage it is unlikely that one receptor can substitute for another.

Furthermore we are asking which RARs are involved in the survival of normal adult motoneurons, since other RARs may be involved in the survival of developing motoneurons. Such dual functions of the same molecule have been shown before. For instance, in the developing nervous system, NGF is required for the survival of the developing peripheral neurons, whereas in the adult the peripheral neurons do not require NGF for their survival but it has been shown to be involved in neurite outgrowth (Lindsay, 1988Go). Hence, the generation of retinoid-deficient animals may lead to the discovery of novel roles for other retinoid receptors in the adult.

A retinoid signalling defect is present in patients with spontaneous motoneuron disease
In human spontaneous motoneuron disease, by counting the number of motoneurons, we found a decrease in the number of RAR{alpha}-positive neurons and raldh-2-positive neurons in the diseased state compared with control samples. As well as the loss of motoneurons, all three transcripts assayed, RAR{alpha}, islet-1 and raldh-2, were dramatically reduced in the diseased motoneurons compared with the control tissue samples. The same loss in RAR{alpha} in motoneurons of diseased patients was observed as in retinoid-deficient rats. In addition there was a loss of islet-1 expression in the motoneurons, suggesting that, as in the embryonic CNS, RA regulates this gene in the adult.

Therefore, our results suggest that a cause of the disease in humans is retinoid signalling defect. This is further supported by our observations that motoneuron disease in the rat is a consequence of a retinoid signalling pathway defect since the animals were fed a retinoid-deficient diet, thus the loss of motoneurons must be a consequence of lack of retinoids. The loss of motoneurons does not precede the loss of retinoid signalling. Most if not all the motoneurons in the retinoid-deficient rat had lost RAR{alpha} expression. This loss of expression included those motoneurons that had vacuolations and were therefore destined to undergo cell death. Also if the defect in the retinoid signalling pathway was a consequence of motoneuron disease then in the surviving motoneurons of both the retinoid-deficient rat and human motoneuron-diseased samples, there would be a downregulation of both RAR{alpha} and raldh-2 compared with the controls. However, it is only in the human-diseased samples that both transcripts are downregulated.

RA synthesis may be a key factor in motoneuron disease
The sequence of events leading to motoneuron disease is likely to be loss of raldh-2 expression, followed by the depletion of cellular retinoids. This would result in the loss of RAR{alpha} activation and expression. Eventually a downregulation of islet-1 would occur, which is either before or after, an increase in neurofilament expression and the consequent motoneuron cell death. It is unlikely that RAR{alpha} can regulate raldh-2 expression since it makes the ligand, which RAR{alpha} requires in order to activate gene transcription. Indeed it has already been shown that raldh-2 slightly precedes the expression of RARß in differentiating limbs (Niederreither et al., 1997Go).

Factors that regulate raldh-2 may be associated with motoneuron disease. One of the factors is unlikely to be RA itself, since in the retinoid-deficient rat model there was no difference in the levels of raldh-2 in their motoneurons compared with the normally fed rats. This suggests that RA does not regulate raldh-2 expression in the adult rat motoneurons. Therefore, in both the retinoid deficient and normally fed rats, the factors that regulate raldh-2 are probably still present. By contrast, in human motoneuron disease it is these factors that regulate raldh-2 that are absent since the enzyme is downregulated in diseased motoneurons compared with normal samples. What may these factors be? Interestingly it has been proposed that neurotrophins such as NT-3 may be useful for treating motoneuron disease (Haase et al., 1998Go; Haase et al., 1997Go; Sagot et al., 1998Go), and we have already shown that a related neurotrophin, NGF, can activate raldh-2 transcription (Corcoran and Maden, 1999Go). It will be of great interest to identify the factors that regulate raldh-2 expression and to see if these are also deficient in motoneuron disease patients. Since the same pathology is seen in spontaneous and familial cases of motoneuron disease, it will also be of interest to ask if retinoids can regulate genes involved in familial forms of the disease. Recently it has been shown that the SOD1 promoter contains a binding site for the orphan receptor peroxisome proliferator-activated receptor (PPAR), which can be induced to bind to the promoter by both RA and 9-cis RA (Yoo et al., 1999Go). This provides further support for the involvement of the retinoid signalling pathway in human motoneuron disease.


    Acknowledgments
 
We thank the Wellcome Trust and BBSERC for financial support for this work. The MRC London Brain Bank for Neurodegenerative diseases at the Institute of Psychiatry for providing human tissue.


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Carpenter, S. (1968). Proximal axonal enlargement in motor neuron disease. Neurology 18,841 -851.[Free Full Text]

Chou, S. M. and Fakadej, A. V. (1971). Ultrastructure of chromatolytic motoneurons and anterior spinal roots in a case of Werdnig-Hoffmann disease. J. Neuropathol. Exp. Neurol. 30,368 -379.[Medline]

Corcoran, J. and Maden, M. (1999). Nerve growth factor acts via retinoic acid synthesis to stimulate neurite outgrowth. Nat. Neurosci. 2,307 -308.[CrossRef][Medline]

Corcoran, J., Shroot, B., Pizzey, J. and Maden, M. (2000). The role of retinoic acid receptors in neurite outgrowth from different populations of embryonic mouse dorsal root ganglia. J. Cell Sci. 113,2567 -2574.[Abstract]

Corcoran, J. P. and Ferretti, P. (1999). RA regulation of keratin expression and myogenesis suggests different ways of regenerating muscle in adult amphibian limbs. J. Cell Sci. 112,1385 -1394.[Abstract]

Delisle, M. B. and Carpenter, S. (1984). Neurofibrillary axonal swellings and amyotrophic lateral sclerosis. J. Neurol. Sci. 63,241 -250.[CrossRef][Medline]

Deng, H. X., Hentati, A., Tainer, J. A., Iqbal, Z., Cayabyab, A., Hung, W. Y., Getzoff, E. D., Hu, P., Herzfeldt, B. and Roos, R. P. (1993). Amyotrophic lateral sclerosis and structural defects in Cu,Zn superoxide dismutase. Science 261,1047 -1051.[Abstract/Free Full Text]

Duester, G. (1998). Alcohol dehydrogenase as a critical mediator of retinoic acid synthesis from vitamin A in the mouse embryo. J. Nutr. 128,459S -462S.

Eddleston, M. and Mucke, L. (1993). Molecular profile of reactive astrocytes—implications for their role in neurologic disease. Neuroscience 54, 15-36.[CrossRef][Medline]

Haase, G., Kennel, P., Pettmann, B., Vigne, E., Akli, S., Revah, F., Schmalbruch, H. and Kahn, A. (1997). Gene therapy of murine motor neuron disease using adenoviral vectors for neurotrophic factors. Nat. Med. 3,429 -436.[CrossRef][Medline]

Haase, G., Pettmann, B., Vigne, E., Castelnau-Ptakhine, L., Schmalbruch, H. and Kahn, A. (1998). Adenovirus-mediated transfer of the neurotrophin-3 gene into skeletal muscle of pmn mice: therapeutic effects and mechanisms of action. J. Neurol. Sci. 160 Suppl. 1,S97 -105.

Hirano, A., Donnenfeld, H., Sasaki, S. and Nakano, I. (1984a). Fine structural observations of neurofilamentous changes in amyotrophic lateral sclerosis. J. Neuropathol. Exp. Neurol. 43,461 -470.[Medline]

Hirano, A., Nakano, I., Kurland, L. T., Mulder, D. W., Holley, P. W. and Saccomanno, G. (1984b). Fine structural study of neurofibrillary changes in a family with amyotrophic lateral sclerosis. J. Neuropathol. Exp. Neurol. 43,471 -480.[Medline]

Hughes, J. S., Lienhardt, H. F. and Aubel, C. E. (1924). Nerve degeneration resulting from avitaminosis A. J. Nutrition 2,183 -186.

Irving, J. T. and Richards, M. B. (1938). Early lesions of vitamin A deficiency. J. Physiol. 94,307 -321.

Jackson, C. E. and Bryan, W. W. (1998). Amyotrophic lateral sclerosis. Semin. Neurol. 18, 27-39.[Medline]

Kastner, P., Chambon, P. and Leid, M. (1994). Role of nuclear retinoic acid receptors in the regulation of gene expression. In Vitamin A in Health and Disease (R. Blomhoff ed.), pp. 189-238. New York: Marcel Dekker Inc.

Kliewer, S. A., Umesono, K., Evans, R. M. and Mangelsdorf, D. J. (1994). The retinoid X receptors: modulators of multiple hormonal signalling pathways. In Vitamin A in Health and Disease (R. Blomhoff ed.), pp. 239-255. New York: Marcel Dekker Inc.

Lee, M. K., Marszalek, J. R. and Cleveland, D. W. (1994). A mutant neurofilament subunit causes massive, selective motor neuron death: implications for the pathogenesis of human motor neuron disease. Neuron 13,975 -988.[CrossRef][Medline]

Leid, M., Kastner, P. and Chambon, P. (1992). Multiplicity generates diversity in the retinoic acid signalling pathways. Trends Biochem. Sci. 17,427 -433.[CrossRef][Medline]

Leroy, P., Krust, A., Zelent, A., Mendelsohn, C., Garnier, J. M., Kastner, P., Dierich, A. and Chambon, P. (1991). Multiple isoforms of the mouse retinoic acid receptor alpha are generated by alternative splicing and differential induction by retinoic acid. EMBO J. 10,59 -69.[Medline]

Lindsay, R. M. (1988). Nerve growth factors (NGF, BDNF) enhance axonal regeneration but are not required for survival of adult sensory neurons. J. Neurosci. 8,2394 -2405.[Abstract]

Maden, M. (1998). The role of retinoids in developmental mechanisms in embryos. Subcell. Biochem. 30, 81-111.[Medline]

Mangelsdorf, D. J. and Evans, R. M. (1995). The RXR heterodimers and orphan receptors. Cell 83,841 -850.[CrossRef][Medline]

Montgomery, D. L. (1994). Astrocytes: form, functions, and roles in disease. Vet. Pathol. 31,145 -167.[Abstract]

Mulder, D. W., Kurland, L. T., Offord, K. P. and Beard, C. M. (1986). Familial adult motor neuron disease: amyotrophic lateral sclerosis. Neurology 36,511 -517.[Abstract]

Niederreither, K., McCaffery, P., Drager, U. C., Chambon, P. and Dolle, P. (1997). Restricted expression and retinoic acid-induced downregulation of the retinaldehyde dehydrogenase type 2 (RALDH-2) gene during mouse development. Mech. Dev. 62, 67-78.[CrossRef][Medline]

Niederreither, K., Subbarayan, V., Dolle, P. and Chambon, P. (1999). Embryonic retinoic acid synthesis is essential for early mouse post-implantation development. Nat. Genet. 21,444 -448.[CrossRef][Medline]

Niederreither, K., Fraulob, V., Garnier, J. M., Chambon, P. and Dolle, P. (2002). Differential expression of retinoic acid-synthesizing (RALDH) enzymes during fetal development and organ differentiation in the mouse. Mech. Dev. 110,165 -171.[CrossRef][Medline]

Quinn, S. D. and de Boni, U. (1991). Enhanced neuronal regeneration by retinoic acid of murine dorsal root ganglia and of fetal murine and human spinal cord in vitro. In Vitro Cell Dev. Biol. 27,55 -62.[Medline]

Rosen, D. R. (1993). Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 364,362 .[Medline]

Rouleau, G. A., Clark, A. W., Rooke, K., Pramatarova, A., Krizus, A., Suchowersky, O., Julien, J. P. and Figlewicz, D. (1996). SOD1 mutation is associated with accumulation of neurofilaments in amyotrophic lateral sclerosis. Ann. Neurol. 39,128 -131.[CrossRef][Medline]

Sagot, Y., Rosse, T., Vejsada, R., Perrelet, D. and Kato, A. C. (1998). Differential effects of neurotrophic factors on motoneuron retrograde labeling in a murine model of motoneuron disease. J. Neurosci. 18,1132 -1141.[Abstract/Free Full Text]

Shibata, N., Asayama, K., Hirano, A. and Kobayashi, M. (1996). Immunohistochemical study on superoxide dismutases in spinal cords from autopsied patients with amyotrophic lateral sclerosis. Dev. Neurosci. 18,492 -498.[Medline]

Sockanathan, S. and Jessell, T. M. (1998). Motor neuron-derived retinoid signaling specifies the subtype identity of spinal motor neurons. Cell 94,503 -514.[CrossRef][Medline]

Straube-West, K., Loomis, P. A., Opal, P. and Goldman, R. D. (1996). Alterations in neural intermediate filament organization: functional implications and the induction of pathological changes related to motor neuron disease. J. Cell Sci. 109,2319 -2329.[Abstract]

Wuarin, L. and Sidell, N. (1991). Differential susceptibilities of spinal cord neurons to retinoic acid- induced survival and differentiation. Dev. Biol. 144,429 -435.[CrossRef][Medline]

Yoo, H. Y., Chang, M. S. and Rho, H. M. (1999). Induction of the rat Cu/Zn superoxide dismutase gene through the peroxisome proliferator-responsive element by arachidonic acid. Gene 234,87 -91.[CrossRef][Medline]





This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Corcoran, J.
Right arrow Articles by Maden, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corcoran, J.
Right arrow Articles by Maden, M.