|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |

NRL of Protein Biochemistry, School of Biological Sciences, Seoul
National University, 56-1 Shinreem-dong, Kwanak-gu, Seoul 151-742, Korea
* These authors contributed equally to this work
Author for correspondence (e-mail:
chchung{at}snu.ac.kr
)
Accepted 8 April 2002
| Summary |
|---|
|
|
|---|
Key words: Myoblast fusion, Dephosphorylation, Okadaic acid, Myristoylation, Filamentous actin
| Introduction |
|---|
|
|
|---|
The myristoylated alanine-rich C kinase substrate (MARCKS) is an abundant,
high affinity cellular substrate for PKC. It has been implicated in various
cellular events, such as cell mobility, neurosecretion and cell transformation
(Aderem, 1992a
;
Blackshear, 1993
). One of the
striking features of MARCKS is its phosphorylation-dependent translocation
between the cytosol and the plasma membrane. The activation of PKC in various
systems leads to phosphorylation of MARCKS and its reversible translocation
from the plasma membrane to the cytosolic compartment of the cells
(Thelen et al., 1991
;
Wang et al., 1989
). MARCKS is
able to crosslink filamentous actins in the plasma membrane, and the
phosphorylation of MARCKS dissociates the filamentous actin crosslinking and
translocates it to the cytosol (Hartwig et
al., 1992
). Therefore, the subcellular localization of MARCKS is
undoubtedly essential to its function in the regulation of the cytoskeleton
dynamics, particularly in the interaction of actin filaments at the plasma
membrane.
Ser/Thr-specific protein phosphatases are divided into two groups, type-1
and type-2 (Ingebritsen and Cohen,
1983a
; Ingebritsen and Cohen,
1983b
). The type-1 protein phosphatase (PP-1) preferentially
dephosphorylates the ß-subunit of phosphorylase kinase and is inhibited
by nanomolar concentrations of two heat-stable proteins, termed protein
phosphatase inhibitor-1 and -2
(Ingebritsen and Cohen, 1983a
;
Ingebritsen and Cohen, 1983b
),
as well as by micromolar concentrations of okadaic acid
(Bialojan and Takai, 1988
;
Haystead et al., 1989
;
Cohen et al., 1990
). By
contrast, the type-2 protein phosphatases (PP-2), comprising PP-2A, PP-2B and
PP-2C, specifically dephosphorylate the
-subunit of phosphorylase
kinase (Ingebritsen and Cohen,
1983a
; Ingebritsen and Cohen,
1983b
). Their activities are not affected by the inhibitor
proteins, but PP-2A is specifically inhibited by another heat stable protein
(I1PP2A) and extremely sensitive to nanomolar
concentrations of okadaic acid (Cohen,
1989
; Li et al.,
1996
). The bombesin- or vasopressin-stimulated phosphorylation of
MARCKS is dynamically reduced upon removal of the PKC activator in Swiss 3T3,
indicating that the phosphatase activity against MARCKS is present and could
regulate the phosphorylation state of the protein
(Rodriguez-Pena et al., 1986
).
Moreover, okadaic acid, which inhibits PP-1 and PP-2A, shows little or no
effect on MARCKS phosphorylation on its own, but strongly inhibits the
dephosphorylation of MARCKS, which were phosphorylated upon activation of PKC
(Clarke et al., 1993
).
We have recently shown that MARCKS translocates from the cytosol to the
plasma membrane while mononucleated myoblasts fuse to form multinucleated
myotubes (Kim et al., 2000
).
This MARCKS translocation was in part due to a decrease in the expression of
PKC
, which is the major enzyme responsible for MARCKS phosphorylation,
during the myogenic process. We have also demonstrated that treatment with
PMA, an activator of the protein kinase, blocks both MARCKS translocation and
myoblast fusion. In order to clarify further whether the MARCKS shuttling is
indeed involved in myogenesis, we examined the effect of okadaic acid on
translocation of MARCKS during the differentiation process. In the present
studies, we show that okadaic acid prevents the translocation of MARCKS from
the cytosol to the plasma membrane and that the dephosphorylating activity
against MARCKS markedly increases during the course of myogenesis. In
addition, PP-1 was found to be the major enzyme responsible for the MARCKS
dephosphorylation. Moreover, overexpression of MARCKS carrying a mutation that
prevents myristoylation and thus blocks its membrane translocation impaired
the fusion of cultured myoblasts. Therefore, we suggest that the protein
phosphatase-1-mediated MARCKS localization at the membrane is involved in the
fusion of embryonic muscle cells.
| Materials and Methods |
|---|
|
|
|---|
-32P]ATP was obtained from
Amersham; FuGENE 6 and complete protease inhibitor cocktail were from
Boeringher Mannheim; okadaic acid, tautomycin, Ro-31-8220, protein phosphatase
inhibitor-2, and protein phosphatase-2A inhibitor were from Calbiochem;
rhodamine-phalloidin was from Molecular Probes. pcDNA3.1/myc-His and
Vectashield were obtained from Invitrogen and Vector Laboratories,
respectively. Antibodies against PP-1, c-Myc, and phospho-MARCKS (Ser152/156)
were from Transduction Laboratories, Santa Cruz Biotechnology, and Cell
Signaling Technologies, respectively. All secondary antibodies were from
Jackson Immunoresearch. All other materials were purchased from Sigma, unless
otherwise indicated.
Cell culture
Myoblasts from breast muscle of 12-day-old chick embryos were prepared as
described previously (Ha et al.,
1979
; Kim et al.,
1992a
). The cells were plated on collagen-coated culture dishes at
a concentration of 5x105 cells/ml in minimum essential medium
(MEM) containing 10% (v/v) horse serum, 10% (v/v) chick embryo extract, and 1%
(v/v) antibiotic/antimycotics solution. One day after the cell seeding, the
culture medium was changed with the same medium but containing 2% embryo
extract for induction of differentiation. The cells were subjected to Giemsa
staining, and the degree of myoblast fusion was determined as the percentage
of the number of nuclei in fused cells to the total number of nuclei in 10
randomly chosen the fields under a microscope. Cells containing more than
three nuclei were regarded as fused cells.
Preparation of subcellular fractions
Myoblasts cultured for appropriate periods were washed three times with
ice-cold Earl's balanced salt solution (EBSS), harvested by centrifugation,
and kept frozen at -70°C until use. The cells were resuspended in 50 mM
Tris-HCl (pH 7.4), 5 mM MgCl2, 1 mM dithiothreitol (DTT), and
1x complete protease inhibitor cocktail, and preparation of their
subcellular fractions was performed as described previously
(Kim et al., 2000
). Protein
concentration was determined by a previously described method
(Bradford, 1976
) or by using
bicinchoninic acid when Triton X-100 was present
(Smith et al., 1985
). Bovine
serum albumin was used as a standard.
Preparation of 32P-labeled MARCKS and phosphatase
assay
Phospho-MARCKS was prepared using purified MARCKS and partially purified
PKC
preparation, which was obtained by the heparin-agarose
chromatography of the muscle extracts as described previously
(Kim et al., 2000
). Reaction
mixtures contained 20 mM Hepes (pH 7.4), 0.25 mM EDTA, 0.25 mM EGTA, 1 mM
CaCl2, 1 mM DTT, 5 mM MgCl2 and 0.15 mM
[
-32P]ATP (0.05 mCi/ml). After incubating them for 3 minutes
at 25°C, the samples were heated for 3 minutes at 95°C and centrifuged
at 15,000 g for 30 minutes. The resulting 32P-labeled
MARCKS was used as the substrate for assaying the phosphatase activity. The
enzyme activity was determined by incubation of 32P-labeled MARCKS
with the soluble extracts obtained from the cultured myoblasts in 50 mM Hepes
(pH 7.4), 1 mM EDTA, 1 mM EGTA, 5 mM MgCl2, 1 mM DTT, 1x
complete protease inhibitor cocktail, and 100 nM Ro-31-8220 or staurosporine.
Incubations were performed for 30 minutes at 30°C and stopped by addition
of 2% SDS solution containing 1% 2-mercaptoethanol. The samples were heated
for 3 minutes at 95°C and subjected to polyacrylamide gel electrophoresis
in 10% slab gels under denaturing conditions (SDS-PAGE)
(Laemmli, 1970
), followed by
autoradiography. When inhibitors were included, the extracts were incubated
with them for 15 minutes prior to the addition of 32P-labeled
MARCKS.
Immunoprecipitation of PP-1
Myoblasts cultured for 48 hours were resuspended in 50 mM Tris-HCl (pH
7.4), 150 mM NaCl, 5 mM MgCl2 and 1x complete protease
inhibitor cocktail. The cells were disrupted by sonication on ice and
centrifuged at 15,000 g for 30 minutes. The supernatants were
incubated with 10 µg of anti-PP-1 IgG or preimmune IgG at 4°C for 2
hours in a rotating shaker. They were then added with 40 µl of 50% (v/v)
protein A-Sepharose in the same buffer and incubated for 1 hour. After
centrifugation, the supernatants were subjected to phosphatase assay. They
were also subjected to SDS-PAGE as above, followed by autoradiography.
Plasmid construction
Since a stable cell line cannot be established with the primary culture of
myoblasts and since these cells have a relatively low efficiency of
transfection, Myc-tagged MARCKS were prepared for identification of the
transfected cells. The N/S mutant carries the Asn residue in the
phosphorylation domain of MARCKS in place of Ser
(Swierczynski and Blackshear,
1996
). In the A2G2 mutant, the Gly residue
next to the N-terminus of MARCKS was substituted with Ala. PCR reactions were
performed using the cDNAs for the wild-type MARCKS and its mutant forms as the
templates, and oligonucleotide primers carrying the HindIII and
XbaI restriction sites. The sequences of the primers are as follows:
primer 1, TGTTAAGCTTGCCACCATGGGTGCC, which includes a HindIII site;
primer 2, TGTTAAGCTTGCCACCATGGCTGCC, which has an altered sequence that can
complement with the A2G2 mutation site as well as the
HindIII site; primer 3, GCGGTCTAGACTCCGCCGGCTCGGC, which has a
XbaI site. The PCR products were cut off by treatment with
HindIII and XbaI and ligated into the
pcDNA3.1/myc-His plasmid that had been cut with the same enzymes.
Thus, in the resulting plasmids, the cDNAs for MARCKS and its mutant forms are
under control of the cytomegalovirus (CMV) promoter/enhancer. These constructs
also have a polyadenylation signal of the bovine growth hormone (BGH)
terminator at their 3'-termini.
Transient transfection of myoblasts
The cells were seeded on 100 mm plates at a density of
1.0x105 cells/ml and cultured for 24 hours. To prepare DNA
for transfection, 12 µl of FuGENE 6 was diluted with 0.4 ml of MEM and
incubated for 5 minutes at room temperature. The diluted solution was slowly
added to the pcDNA derivatives (4 µg), mixed gently, and incubated for 15
minutes. The cultured myoblasts were rinsed once with MEM and slowly added
with the FuGENE 6-treated DNA solution. After incubation for 4 hours, the
transfected cells were rinsed with and cultured in the differentiation medium
for 48 hours.
FACS analysis
Myoblasts that had been cultured for 24 hours were transfected with the
pcDNA derivatives and incubated for 24 hours. The cells were washed twice in
PBS and fixed in 2% paraformaldehyde for 15 minutes. They were again washed
twice in PBS and incubated in PBS containing 0.5% saponin and 2% horse serum
to permeabilize the cells and saturate nonspecific binding sites. The cells
were incubated with the monoclonal antibody raised against c-Myc (9E10) and a
polyclonal antibody raised against creatine kinase for 1 hour, and then with
fluorescein isothiocyanate (FITC)-conjugated donkey anti-mouse IgG and
phycoerythrin (PE)-conjugated goat anti-rabbit IgG, respectively, for the next
1 hour. They were then washed twice in PBS, separated by collagenase, and
resuspended in PBS. The samples were analyzed with a FACStarplus (Becton
Dickinson), and data were analyzed with CellQuest software.
Immunocytochemistry
The cells plated on collagen-coated glass coverslips were fixed with 3.7%
paraformaldehyde in PBS for 10 minutes, followed by permeabilization with 0.5%
Triton X-100 in PBS. All subsequent dilutions and washes were carried out with
PBS containing 0.1% Triton X-100 (PBST). Nonspecific binding sites were
saturated by incubation with 3% horse serum and 10% gelatin in PBST for 1
hour. The cells were incubated with the antibody raised against c-Myc for 1
hour and then with FITC-conjugated donkey anti-mouse IgG for the next 1 hour.
For detection of filamentous actin, the cells were incubated with
rhodamine-phalloidin. The coverslips were mounted in Vectashield and viewed in
a laser scanning confocal microscope (Carl Zeiss LSM 510). FITC and rhodamine
were excised by 488 nm argon and 543 nm HeNe laser, and the images were
filtered by bandpass 505-530 nm and longpass 585 nm filters, respectively. The
acquired images were processed with Adobe PhotoShop and printed with Tektronix
phaser 450. No fluorescence was detected if primary antibody was omitted.
| Results |
|---|
|
|
|---|
|
To determine whether the dephosphorylating activity against MARCKS might change during myogenesis, soluble extracts were obtained from myoblasts that had been cultured for various periods and assayed for their dephosphorylation activity by incubation with 32P-labeled MARCKS. To prevent the endogenous activity of PKCs, the extracts were pretreated with Ro-31-8220, a potent inhibitor of the enzymes. The samples were then subjected to SDS-PAGE followed by autoradiography. The ability of the soluble extracts to dephosphorylate 32P-labeled MARCKS markedly increases (Fig. 2A) as the cells fuse to form myotubes (Fig. 2C). Moreover, this increase in the dephosphorylating activity was particularly evident in the extracts obtained from cells that are competent or committed for membrane fusion (i.e. cultured for 36-48 hours). However, treatment with okadaic acid or tautomycin strongly inhibited both dephosphorylating activity and membrane fusion (Fig. 2A and C, respectively). To determine whether the increase in the dephosphorylating activity indeed correlates with the phosphorylation state of MARCKS in the cells, the same extracts were subjected to immunoblot analysis using an antibody that reacts only with the phosphorylated form of MARCKS. As shown in Fig. 2B, the level of the phospho-MARCKS proteins decreased in parallel with the increase in the dephosphorylating activity. Moreover, treatment with okadaic acid or tautomycin blocked the decrease in the level of phospho-MARCKS. These results suggest that the MARCKS-specific phosphatase activity is upregulated just before or during the onset of myoblast fusion and may be required for myoblast fusion.
|
Identification of protein phosphatase responsible for MARCKS
dephosphorylation
MARCKS that was phosphorylated can be almost completely dephosphorylated by
the purified catalytic subunit of PP-2A
(Clarke et al., 1993
). The
purified catalytic subunit of PP-1 (PP-1C) can also dephosphorylate MARCKS,
although somewhat less efficiently than the catalytic subunit of PP-2A
(Clarke et al., 1993
). To
identify the protein phosphatase(s) that is responsible for dephosphorylation
of MARCKS during myogenesis, the soluble extracts obtained from the cells that
had been cultured for 48 hours were incubated with 32P-labeled
MARCKS in the presence of increasing concentrations of tautomycin or okadaic
acid. As shown in Fig. 3A, both
tautomycin (open circle) and okadaic acid (closed circle) inhibited the
phosphatase activity in a dose-dependent fashion. The concentrations required
for a half-maximum inhibition (IC50) by tautomycin and okadaic acid
were about 1 nM and 60 nM, respectively. Since PP-2C is insensitive to both
inhibitors and since the inhibition of PP-2B by tautomycin needs a more than
5000-fold higher concentration of the agents
(Mackintosh and Klumpp, 1990
),
it appears unlikely that PP-2B and PP-2C act on phosphorylated MARCKS in
differentiating myoblasts. In addition, it has been reported that PP-2A
requires levels of okadaic acid at least 100-fold lower than those of PP-1 for
complete inhibition, although the drug can inhibit both PP-1 and PP-2A
(Bialojan and Takai, 1988
).
These results suggest that PP-1 is responsible for dephosphorylation of
MARCKS.
|
To clarify further the involvement of PP-1 in MARCKS dephosphorylation, the same cell extracts were subjected to immunoprecipitation by treatment with an antibody raised against PP-1C. The resulting supernatants were then incubated with 32P-labeled MARCKS, followed by SDS-PAGE and autoradiography. As shown in Fig. 3B, treatment with the anti-PP-1C IgG completely prevented the dephosphorylating activity (lane c), unlike treatment with preimmune IgG (lane b). We also examined the effects of phosphatase inhibitors on dephosphorylation of 32P-labeled MARCKS. Fig. 3C shows that the dephosphorylating activity is strongly inhibited by protein phosphatase inhibitor-2 (lane b), which is a specific inhibitor of PP-1, but not by protein phosphatase-2A inhibitor (I1PP2A) (lane c). Moreover, the protein phosphatase activity was inhibited by treatment with both inhibitor proteins to an extent similar to that seen with protein phosphatase inhibitor-2 alone (lane d). Thus, it is likely that PP-1 is the major enzyme responsible for dephosphorylation of MARCKS during the myogenic differentiation.
To determine whether the increase in the dephosphorylating activity against 32P-labeled MARCKS during myogenesis (Fig. 2A) might be due to a change in the expression of PP-1C, the same extracts were subjected to immunoblot analysis using the anti-PP-1C IgG. However, the protein level of PP-1C remained nearly constant during the entire culture periods (Fig. 4). PP-1 is known to consist of multiple subunits, including catalytic, targeting, and regulatory subunits. Thus, it is possible that the expression of either targeting or regulatory subunit or both of them may change during myogenesis and result in an increase in the capacity of dephosphorylating MARCKS.
|
Effects of N/S and A2G2 mutations on MARCKS
translocation
To clarify whether MARCKS translocation is involved in myoblast fusion, we
first examined the effects of the mutations that could influence membrane
translocation of MARCKS. The cDNAs for two different mutant forms of MARCKS,
N/S and A2G2, were used for cell transfection
(Swierczynski and Blackshear,
1996
). In N/S, the Ser phosphorylation site is replaced by Asn and
therefore cannot be phosphorylated by protein kinases. In
A2G2, the Gly residue, which is located next to the
N-terminus of MARCKS and serves as the myristoylation site, is substituted
with Ala. Thus, N/S should be targeted to the plasma membrane, while
A2G2 should remain in the cytosol. The two forms of
MARCKS were also Myc-tagged for their identification upon immunoblot analysis
using anti-Myc antibodies.
Myoblasts that had been cultured for 24 hours were transfected with the cDNAs and further cultured for 48 hours in the absence or presence of okadaic acid (Fig. 5B,C, panels a and b, respectively). Total cell lysates were prepared from the cells and subjected to immunoblot analysis. While Fig. 5A shows the endogenous MARCKS proteins that were detected with an anti-MARCKS antibody, Fig. 5B represents the Myc-tagged, wild-type MARCKS (Wt) and its mutant forms (N/S and A2G2) that were expressed from the transfected cDNAs and detected with an anti-Myc antibody. Of note is that A2G2, which should lack the myristoyl group, migrated faster than the Myc-tagged, wild-type MARCKS or N/S in the gel. These results show that the transfected cells could overexpress the Myc-tagged MARCKS proteins. We then examined the effects of the mutations in the phosphorylation and myristoylation sites on MARCKS translocation in vivo. The soluble and membrane fractions were obtained from the cultured myoblasts that had been transfected with the cDNAs for the Myc-tagged wild-type MARCKS, N/S and A2G2. These fractions were then subjected to immunoblot analysis using an anti-Myc antibody as above. When the transfected cells were cultured in the absence of okadaic acid, the majority of the wild-type MARCKS (Wt) and N/S were recovered in the membrane fraction (Fig. 5Ca). Upon treatment with the drug, the wild-type MARCKS was recovered in the soluble fraction while the membrane translocation of N/S was not affected (Fig. 5Cb). In contrast, A2G2 remained exclusively in the soluble fraction, whether the transfected cells were cultured in the absence or presence of okadaic acid. These results indicate that dephosphorylation and myristoylation of MARCKS are essential for its translocation in vivo from the cytosol to the plasma membrane of the cultured myoblasts.
|
Involvement of MARCKS translocation in myoblast fusion
To determine whether translocation of MARCKS is indeed involved in membrane
fusion of cultured myoblasts, the cells were transfected with the cDNAs for
the Myc-tagged, wild-type MARCKS, N/S and A2G2 as above,
cultured for 48 hours, and subjected to immunostaining using an anti-Myc
antibody. They were then observed under a confocal microscope. The cells
expressing the wild-type MARCKS (Wt) (Fig.
6A) and N/S (Fig.
6D) readily fused to form multinucleated myotubes with intense
staining of the protein along the plasma membrane. In contrast, the cells
expressing A2G2 had an unfused, bipolar shape with
diffuse staining of MARCKS in the cytosol
(Fig. 6G). Thus, it appears
that translocation of MARKS from the cytosol to the plasma membrane is
associated with or a requisite step for membrane fusion of cultured
myoblasts.
|
To determine whether the MARCKS translocation during myogenesis is correlated with its capability of crosslinking filamentous actin, the same cells were also stained using pallotoxin, a selective ligand of filamentous actin but not of the globular form. The cytoskeletal networks of filamentous actin in cells expressing the wild-type MARCKS and N/S were co-localized with the membrane-translocated MARCKS (Fig. 6A-C and D-F, respectively). However, construction of the filamentous actin network was impaired in the cells expressing A2G2 (Fig. 6G-I), although unfused myoblasts showed longitudinally penetrated actin filaments (data not shown). These results suggest that MARCKS translocation to the plasma membrane is tightly associated with its ability to crosslink filamentous actin, which may positively influence the membrane fusion of cultured myoblasts.
Effects of N/S and A2G2 mutations on expression
of muscle specific proteins
During myogenesis, the membrane fusion of myoblasts accompanies the
accumulation of muscle-specific proteins, such as creatine kinase and myosin
heavy chain. To examine whether the prevention of MARCKS translocation and
hence blocking the myoblast fusion might influence the expression of
muscle-specific proteins, the cells were transfected with the cDNAs for the
Myc-tagged wild-type MARCKS, N/S and A2G2, as above.
After culturing the cells for 48 hours, they were stained with both anti-Myc
and anti-creatine kinase antibodies, followed by FACS analysis to measure the
expression levels of creatine kinase in the transfected cells only.
Fig. 7 shows that accumulation
of creatine kinase could be detected not only in cells expressing the
wild-type MARCKS and N/S but also in cells expressing
A2G2 (although its level in cells expressing
A2G2 is significantly less than that seen in those
expressing the wild-type MARCKS and N/S), despite the fact that the latter
cannot fuse to form myotubes, unlike the others. Similar results were obtained
for the expression of myosin heavy chain (data not shown). These results
strongly suggest that the expression of muscle-specific proteins is
independent of the membrane translocation of MARCKS as well as myoblast
fusion.
|
| Discussion |
|---|
|
|
|---|
, which is the major enzyme responsible for the
phosphorylaion of MARCKS (Kim et al.,
2000
In a cell-free system, PP-1, PP-2A and PP-2C could dephosphorylate
recombinant MARCKS or a synthetic peptide containing the phosphorylation
domain of MARCKS. In intact Swiss 3T3 cells, okadaic acid, added at
concentrations for inhibiting PP-1 and PP-2A but not PP-2C, exerts little
effect on MARCKS phosphorylation on its own, but largely prevents the
dephosphorylation of MARCKS that occurred following the activation of PKC by
bombesin with subsequent receptor blockade
(Clarke et al., 1993
).
Therefore, it has been suggested that, although dephosphorylation of MARCKS
can be mediated by PP-2C in vitro, MARCKS might be dephosphorylated by
okadaic-acid-sensitive PP-1 and/or PP-2A in Swiss 3T3.
A number of results obtained in the present studies suggest that PP-1 is the major protein phosphatase that is responsible for the dephosphorylating activity against MARCKS in cultured myoblasts. First, both tautomycin and okadaic acid blocked the dephosphorylating activity against MARCKS at concentrations that can inhibit PP-1 but not PP-2A. Second, immunoprecipitation by an antibody raised against the catalytic subunit of PP-1 (PP-1C), but not by preimmune IgG, prevented the MARCKS dephosphorylating activity. Third, the phosphatase activity was strongly inhibited by the protein phosphatase inhibitor-2, a specific protein inhibitor of PP-1, but not by the inhibitor protein specific to the protein phosphatase-2A. Thus, it appears clear that PP-1 participates in dephosphorylation of MARCKS during myogenesis.
However, it is noteworthy that the concentration of okadaic acid used to
inhibit dephosphorylation effectively in vivo
(Fig. 1, 25 nM) was much lower
than the micromolar concentrations generally accepted to inhibit PP-1 in other
cells (Bialojan and Takai,
1988
; Haystead et al.,
1989
; Cohen et al.,
1990
), which suggests that PP-2A may also participate in MARCKS
dephosphorylation in cultured myoblasts. Furthermore, the concentration of
tautomycin required for prevention of the MARCKS dephosphorylation in vivo was
much higher than that needed in vitro (Figs
1,
3). Favre et al. have
systematically demonstrated using MCF7 cells that the phosphatase inhibitors,
including okadaic acid and tautomycin, have distinct cell permeability
properties (Favre et al.,
1997
). Thus, it appears possible that okadaic acid shows much
higher permeability to myoblasts than to other cells, whereas tautomycin has
the opposite property.
Also noteworthy is the observation that the protein level of PP-1C remained
nearly constant during the entire time course of myogenesis, despite the fact
that the dephosphorylating activity against MARCKS markedly increased during
the same period. In vivo, PP-1C exists as a complex with other proteins that
target it to particular subcellular localizations, modify its substrate
specificity, and regulates its enzyme activity
(Lavoinne et al., 1991
). In
the rabbit skeletal muscle, PP-1C has been shown to interact with glycogen
particle (PP-1G), sarcoplasmic reticulum (PP-1SR), myofibrils (PP-1M), and the
cytoplasmic inhibitor-2 protein (PP-1I)
(Dent et al., 1990
). In
insulin-stimulated L6 rat myoblasts, the protein level of PP-1G dramatically
increases in response to the agonist, while that of PP-1C remains constant
(Srinivasan and Begum, 1994
).
Thus, it appears possible that the increase in the dephosphorylation activity
against MARCKS in cultured chick myoblasts may be regulated by the other
subunits of PP-1, such as the targeting or regulatory subunits. Further
studies are required to identify the subunit(s), whose expression may change
and hence alter the activity of PP-1C during differentiation of chick
myoblasts.
The membrane translocation of MARCKS appears to be essential or a requisite
event in the membrane fusion of cultured myoblasts. Distribution of MARCKS
changes from the cytosol to the plasma membrane of the cells and this
translocation appears to be regulated by both the increase in the
PP-1-mediated MARCKS dephosphorylation and the decrease in the
PKC
-mediated MARCKS phosphorylation during the course of myogenic
differentiation (Kim et al.,
2000
). Furthermore, overexpression of A2G2,
which cannot be targeted to the plasma membrane because it lacks a
myristoylation site, impaired the cell fusion. By contrast, the cells
expressing N/S, which lacks a phosphorylation site and thus readily
translocates to the membrane, underwent fusion similarly to those expressing
the wild-type MARCKS. In addition, formation of filamentous actin cytoskeleton
is largely dependent on translocation of MARCKS to the plasma membrane and its
distribution coincides with that of MARCKS in cells overexpressing the
wild-type MARCKS or N/S. It has been reported that alterations in MARCKS
distribution by PKC-mediated phosphorylation result in disintegration of the
membrane skeleton, and cytochalasin D, an inhibitor of actin polymerization,
enhances PKC-induced translocation of MARCKS to the cytosol
(Douglas et al., 1997
;
Vaaraniemi et al., 1999
).
Together with the fact that MARCKS regulates the cytoskeleton dynamics by
crosslinking the actin filaments in the plasma membrane and that myoblast
fusion accompanies massive cytoskeleton reorganization, we suggest that the
PP-1-mediated MARCKS localization at the membrane is required for the fusion
of embryonic muscle cells.
Stumpo et al. have reported that MARCKS-deficient mice exhibit abnormal
brain development but do not have any obvious defects in other major organs
including muscle, questioning the involvement of MARCKS in myoblast
differentiation (Stumpo et al.,
1995
). However, they also reported that MARCKS is highly expressed
in many developing neuronal tissues in which phenotypic alterations were not
seen in the MARCKS-deficient mouse, as well as in many extracranial tissues in
the mouse. Therefore, they suggested that the MARCKS homologue MRP
(MARCKS-related protein) (Aderem,
1992b
; Blackshear,
1993
) might also be highly expressed in these tissues during
development and prevent them from exhibiting an abnormal phenotype. Similarly,
MRP in embryonic muscle tissues may serve as a functional equivalent of MARCKS
and prevent any defect in muscle development in MARCKS-deficient mice,
although the most sensitive processes would be affected by the reduction in
total amount of `MARCKS equivalents'
(Stumpo et al., 1995
).
Of interest was the finding that expression of muscle-specific proteins,
such as creatine kinase and myosin heavy chain, could occur in the
fusion-arrested myoblasts upon overexpression of A2G2.
This result is consistent with our previous finding that okadaic acid blocks
the membrane fusion of chick myoblasts with little effect on induction of
muscle-specific proteins (Kim et al.,
1991
). It has also been shown that prevention of cell fusion, such
as by prolonged culture in a low-calcium medium or treatment with cytochalasin
B, does not interfere with the synthesis of muscle-specific proteins and the
other differentiative processes, including transport and release of calcium
(Holtzer et al., 1975
;
Constantin et al., 1995
).
Thus, the synthesis of muscle-specific proteins occurring independently of the
blockade of membrane fusion by A2G2 expression could be
an additional example of the uncoupling of biochemical differentiation from
morphological differentiation, despite the fact that both processes normally
occur simultaneously during the myogenic differentiation of embryonic skeletal
muscle cells.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Adamo, S., Caporale, C., Nervi, C., Ceci, R. and Molinaro,
M. (1989). Activity and regulation of calcium-,
phospholipid-dependent protein kinase in differentiating chick myogenic cells.
J. Cell Biol. 108,153
-158.
Aderem, A. (1992a). Signal transduction and the actin cytoskeleton: the roles of MARCKS and profilin. Trends Biochem. Sci. 17,438 -443.[Medline]
Aderem, A. (1992b). The MARCKS brothers: a family of protein kinase C substrates. Cell 71,713 -716.[Medline]
Baek, H. J., Jeon, Y. J., Kim, H. S., Kang, M. S., Chung, C. H. and Ha, D. B. (1994). Cyclic AMP negatively modulates both Ca2+/calmodulin-dependent phosphorylation of the 100-kDa protein and membrane fusion of chick embryonic myoblasts. Dev. Biol. 165,178 -184.[Medline]
Bialojan, C. and Takai, A. (1988). Inhibitory effect of a marine-sponge toxin, okadaic acid on protein phosphatases. Specificity and kinetics. Biochem. J. 256,283 -290.[Medline]
Bischoff, R. and Holtzer, H. (1969). Mitosis
and the processes of differentiation of myogenic cells in vitro. J.
Cell Biol. 41,188
-200.
Blackshear, P. J. (1993). The MARCKS family of
cellular protein kinase C substrates. J. Biol. Chem.
268,1501
-1504.
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72,248 -254.[Medline]
Clarke, P. R., Siddhanti, S. R., Cohen, P. and Blackshear, P. J. (1993). Okadaic acid-sensitive protein phosphatases dephosphorylate MARCKS, a major protein kinase C substrate. FEBS Lett. 336,37 -42.[Medline]
Cohen, P. (1989). The structure and regulation of protein phosphatases. Annu. Rev. Biochem. 58,453 -508.[Medline]
Cohen, P., Holmes, C. F. and Tsukitani, Y. (1990). Okadaic acid: a new probe for the study of cellular regulation. Trends Biochem. Sci. 15, 98-102.[Medline]
Constantin, B., Cognard, C. and Raymond, G. (1995). Myoblast fusion is not a prerequisite for the appearance of calcium current, calcium release, and contraction in rat skeletal muscle cells developing in culture. Exp. Cell Res. 217,497 -505.[Medline]
Dent, P., Lavoinne, A., Nakielny, S., Caudwell, F. B., Watt, P. and Cohen, P. (1990). The molecular mechanism by which insulin stimulates glycogen synthesis in mammalian skeletal muscle. Nature 348,302 -308.[Medline]
Douglas, D. N., Fink, H. S., Rose, S. D., Ridgway, N. D., Cook, H. W. and Byers, D. M. (1997). Inhibitors of actin polymerization and calmodulin binding enhance protein kinase C-induced translocation of MARCKS in C6 glioma cells. Biochim. Biophys. Acta 1356,121 -130.[Medline]
Favre, B., Turowski, P. and Hemmings, B. A.
(1997) Differential inhibition and posttranslational modification
of protein phosphatase 1 and 2A in MCF7 cells treated with calyculin-A,
okadaic acid, and tautomycin. J. Biol. Chem.
272,13856
-13863.
Fulton, A. B., Prives, J., Farmer, S. R. and Penman, S.
(1981). Developmental reorganization of the skeletal framework
and its surface lamina in fusing muscle cells. J. Cell
Biol. 91,103
-112.
Ha, D. B., Boland, R. and Martonosi, A. (1979). Synthesis of the calcium transport ATPase of sarcoplasmic reticulum and other muscle proteins during development of muscles cells in vivo and in vitro. Biochim. Biophys. Acta 585,165 -187.[Medline]
Hartwig, J. H., Thelen, M., Rosen, A., Janmey, P. A., Nairn, A. C. and Aderem, A. (1992). MARCKS is an actin filament crosslinking protein regulated by protein kinase C and calcium-calmodulin. Nature 356,618 -622.[Medline]
Haystead, T. A., Sim, A. T., Carling, D., Honnor, R. C., Tsukitani, Y., Cohen, P. and Hardie, D. G. (1989). Effects of the tumor promoter okadaic acid on intracellular protein phosphorylation and metabolism. Nature 337,78 -81.[Medline]
Holtzer, H., Strahs, K., Biehl, J., Somlyo, A. P. and Ishikawa,
H. (1975). Thick and thin filaments in postmitotic,
mononucleated myoblasts. Science
188,943
-945.
Ingebritsen, T. S. and Cohen, P. (1983a). The protein phosphatases involved in cellular regulation. 1. Classification and substrate specificities. Eur. J. Biochem. 132,255 -261.[Medline]
Ingebritsen, T. S. and Cohen, P. (1983b).
Protein phosphatases: properties and role in cellular regulation.
Science 221,331
-338.
Kim, H. S., Chung, C. H., Kang, M. S. and Ha, D. B. (1991). Okadaic acid blocks membrane fusion of chick embryonic myoblasts in culture. Biochem. Biophys. Res. Commun. 176,1044 -1050.[Medline]
Kim, H. S., Lee, I. H., Chung, C. H., Kang, M. S. and Ha, D. B. (1992a). Ca2+/calmodulin-dependent phosphorylation of the 100-kDa protein in chick embryonic muscle cells in culture. Dev. Biol. 150,223 -230.[Medline]
Kim, S. J., Kim, K. Y., Tapscott, S. J., Winokur, T. S., Park,
K., Fujiki, H., Weintraub, H. and Roberts, A. B. (1992b).
Inhibition of protein phosphatases blocks myogenesis by first altering MyoD
binding activity. J. Biol. Chem.
267,15140
-15145.
Kim, H. S., Lee, I. H., Jeon, Y. J., Chung, C. H. and Ha, D. B. (1993). Sphingosine blocks both membrane fusion and calmodulin-dependent phosphorylation of the 100-kDa protein of chick embryonic myoblasts. Exp. Cell Res. 205,408 -411.[Medline]
Kim, S. S., Kim, J. H., Kim, H. S., Park, D. E. and Chung, C.
H. (2000). Involvement of the
-type protein kinase C
in translocation of myristoylated alanine-rich C kinase substrate (MARCKS)
during myogenesis of chick embryonic myoblasts. Biochem.
J. 347,139
-146.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680 -685.[Medline]
Lavoinne, A., Erikson, E., Maller, J. L., Price, D. J., Avruch, J. and Cohen, P. (1991). Purification and characterization of the insulin-stimulated protein kinase from rabbit skeletal muscle; close similarity to S6 kinase II. Eur. J. Biochem. 199,723 -728.[Medline]
Li, M., Makkinje, A. and Damuni, Z. (1996). Molecular identification of I1PP2A, a novel potent heat-stable inhibitor protein of protein phosphatase 2A. Biochemistry 35,6998 -7002.[Medline]
Mackintosh, C. and Klumpp, S. (1990). Tautomycin from the bacterium Streptomyces verticillauts, another potent and specific inhibitor of protein phosphatases 1 and 2A. FEBS Lett. 277,137 -140.[Medline]
Nadal-Ginard, B. (1978). Commitment, fusion and biochemical differentiation of a myogenic cell line in the absence of DNA synthesis. Cell 15,855 -864.[Medline]
O'Neill, M. C. and Stockdale, F. E. (1972). A
kinetic analysis of myogenesis in vitro. J. Cell Biol.
52, 52-65.
Pauw, P. G. and David, J. D. (1979). Alterations in surface proteins during myogenesis of a rat myoblast cell line. Dev. Biol. 70,27 -38.[Medline]
Rapuano, M., Ross, A. F. and Prives, J. (1989). Opposing effects of calcium entry and phorbol esters on fusion of chick muscle cells. Dev. Biol. 134,271 -278.[Medline]
Rodriguez-Pena, A., Zachary, I. and Rozengurt, E. (1986). Rapid dephosphorylation of a Mr 80,000 protein, a specific substrate of protein kinase C upon removal of phorbol esters, bombesin and vasopressin. Biochem. Biophys. Res. Commun. 140,379 -385.[Medline]
Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J. and Klenk, D. C. (1985). Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76-85.[Medline]
Srinivasan, M. and Begum, N. (1994). Regulation
of protein phosphatase 1 and 2A activities by insulin during myogenesis in rat
skeletal muscle cells in culture. J. Biol. Chem.
269,12514
-12520.
Stumpo, D. J., Bock, C. B., Tuttle, J. S. and Blackshear, P.
J. (1995). MARCKS deficiency in mice leads to abnormal brain
development and perinatal death. Proc. Natl. Acad. Sci.
USA 92,944
-948.
Swierczynski, S. L. and Blackshear, P. J.
(1996). Myristoylation-dependent and electrostatic interactions
exert independent effects on the membrane association of the myristoylated
alanine-rich protein kinase C substrate protein in intact cells. J.
Biol. Chem. 271,23424
-23430.
Thelen, M., Rosen, A., Nairn, A. C. and Aderem, A. (1991). Regulation by phosphorylation of reversible association of a myristoylated protein kinase C substrate with the plasma membrane. Nature 351,320 -322.[Medline]
Toutant, M. and Sobel, A. (1987). Protein phosphorylation in response to the tumor promoter TPA is dependent on the state of differentiation of muscle cells. Dev. Biol. 124,370 -378.[Medline]
Vaaraniemi, J., Palovuori, R., Lehto, V. P. and Eskelinen, S. (1999). Translocation of MARCKS and reorganization of the cytoskeleton by PMA correlates with the ion selectivity, the confluence, and transformation state of kidney epithelial cell lines. J. Cell Physiol. 181,83 -95.[Medline]
Wang, J. K., Walaas, S. I., Sihra, T. S., Aderem, A. and
Greengard, P. (1989) Phosphorylation and associated
translocation of the 87-kDa protein, a major protein kinase C substrate, in
isolated nerve terminals. Proc. Natl. Acad. Sci. USA
86,2253
-2256.
This article has been cited by other articles:
![]() |
J. A. Timmons, O. Larsson, E. Jansson, H. Fischer, T. Gustafsson, P. L. Greenhaff, J. Ridden, J. Rachman, M. Peyrard-Janvid, C. Wahlestedt, et al. Human muscle gene expression responses to endurance training provide a novel perspective on Duchenne muscular dystrophy FASEB J, May 1, 2005; 19(7): 750 - 760. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-H. Disatnik, S. C. Boutet, W. Pacio, A. Y. Chan, L. B. Ross, C. H. Lee, and T. A. Rando The bi-directional translocation of MARCKS between membrane and cytosol regulates integrin-mediated muscle cell spreading J. Cell Sci., September 1, 2004; 117(19): 4469 - 4479. [Abstract] [Full Text] [PDF] |
||||
![]() |
K Nakabayashi, S Makino, S Minagawa, A C Smith, J S Bamforth, P Stanier, M Preece, L Parker-Katiraee, T Paton, M Oshimura, et al. Genomic imprinting of PPP1R9A encoding neurabin I in skeletal muscle and extra-embryonic tissues J. Med. Genet., August 1, 2004; 41(8): 601 - 608. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||