|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
1 Research Institute for Molecular Pathology, Dr Bohr-Gasse 7, A-1030 Vienna,
Austria
2 Technical University Braunschweig, D-38106, Braunschweig, Germany
3 Max Planck Institute of Molecular Cell Biology and Genetics, D-01307 Dresden,
Germany
* Author for correspondence (e-mail: mglotzer{at}nt.imp.univie.ac.at )
Accepted 18 March 2002
| Summary |
|---|
|
|
|---|
Key words: Polarity, Cytokinesis, Cleavage furrow, Protein degradation, Endocytosis
| Introduction |
|---|
|
|
|---|
Another prominent actin-dependent process of early C. elegans
embryos is cytokinesis. To divide a cell into two daughters, the cytoskeleton
forms an actin-based contractile ring in the cell cortex. The contractile ring
assembles between the two poles of the mitotic spindle so that the ingressing
cleavage furrow endows each of the two resulting daughter cells with a
complete set of chromosomes (for a review, see
Glotzer, 2001
). Mutations or
disruption of either actin or myosin result in a failure of cytokinesis in
animal cells (Carter, 1967
;
Guo and Kemphues, 1996
;
Mabuchi and Okuno, 1977
;
Strome and Hill, 1988
).
The actomyosin cytoskeleton has diverse cellular functions in addition to
its role in establishing cellular asymmetry and performing cytokinesis. For
example, the actin cytoskeleton is essential for cell motility, cell-substrate
attachment and maintenance of cellular integrity. These diverse functions
require a dynamic cytoskeleton that can be remodeled to accomplish these
tasks. This flexibility, however, renders the actin cytoskeleton sensitive to
perturbations. For example, merely preventing actin assembly by sequestering
actin monomers (as with Latrunculin A) leads to the depolymerization of
pre-existing actin structures (Coue et al.,
1987
).
Cell volume regulation is thought to be mediated by a host of transporters,
pumps and channels that balance the intracellular concentration of ions, water
and osmolytes (for a review, see Kwon and
Handler, 1995
). Upon hyperosmotic stress, cells lose water, which
leads to a dramatic increase in the concentration of internal ions. Regulated
volume increase (RVI) then occurs, involving the uptake of ions that are
ultimately replaced by compatible osmolytes. Upon hypo-osmotic stress, cells
take up water and swell, triggering a process termed regulated volume decrease
(RVD). In RVD, both ions and osmolytes are actively exported to the
extracellular environment, which leads to the concomitant loss of water and
return to the normal cell volume. However, the molecular mechanism of cellular
osmotic homeostasis remains poorly understood.
Exposing cells to dramatic changes in osmotic conditions leads to
reorganization of the actin cytoskeleton, perhaps as a consequence of its
intrinsic instability. For example, in human cells, the total content of
F-actin decreases in hypo-osmotic and increases in hyper-osmotic conditions
concomitantly with cell volume changes
(Hallows et al., 1996
). In
yeast, both actin cables and cortical actin patches are transiently disrupted
upon osmotic shock (Chowdhury et al.,
1992
). Dictyostelium discoideum responds to hyperosmotic
conditions by relocalizing myosin to the cortex and by significantly
increasing phosphorylation of actin and myosin
(Kuwayama et al., 1996
;
Zischka et al., 1999
). Thus,
the cellular osmotic state impinges on the actin cytoskeleton.
In this study, we have characterized a maternal effect embryonic lethal mutation in C. elegans called cyk-3. In utero, cyk-3 mutant embryos fail to perform cytokinesis and become progressively multinucleated. Not only is cytokinesis defective, but partitioning of P-granules is also impaired. cyk-3 mutant embryos are osmosensitive and appear swollen. Osmotic support can substantially rescue the cytokinesis defect. The cyk-3 gene has been cloned by functional rescue and found to encode an ubiquitin C-terminal hydrolase. These data reveal that deubiquitination is required for cellular osmotic regulation and show that, in the C. elegans embryo, defects in osmoregulation can disrupt cytokinesis and some aspects of embryonic polarity.
| Materials and Methods |
|---|
|
|
|---|
Genetic mapping of cyk-3
cyk-3 maps to LGIII and is not covered by several tested
deficiencies, including sDf121 and sDf125
(Gönczy et al., 1999
). A
cross between the strains cyk-3, unc-32/ qCI and
dpy-18/dpy-18 placed cyk-3 at approximately -1.3 on the
minus arm of chromosome III (17/669 Unc-32 animals gave viable progeny, 0/17
segregated Dpy-18 worms). Recombination mapping using the strain MJ569
positioned cyk-3 proximal to dpy-17 (0/7 Dpy non-Uncs
carried the cyk-3 mutation, 1/1 Unc non-Dpys did carry
cyk-3). Recombination mapping using the strain sma-4, unc-36
positioned cyk-3 between sma-4 and unc-36, close to
sma-4 (5/25 Sma non-Uncs and 15/17 Unc non-Smas carried the cyk-3
mutation).
Rescue experiments
Cosmids spanning the cyk-3 candidate region (kindly provided by
Alan Coulson, Sanger Center, Hinxton, UK), were injected in pools into the
gonads of 10-15 unc-32, cyk-3(t1525)/qCI heterozygous animals,
together with the rol-6(su1006) transgenic marker
(Mello et al., 1991
).
Heterozygous F1 worms carrying the rol-6 marker were transferred to
individual plates to obtain lines segregating Rollers. From these lines,
homozygous unc-32 cyk-3(t1525) worms were scored for viable progeny.
Out of the injected cosmids, only cosmid ZK328 showed rescue activity (3/5
lines produced viable Unc-32 progeny). A 7.5kb genomic BamHI fragment
containing only ZK328.1 and a promoter region was subcloned into pBS-KS+ and
injected into unc-32, cyk-3(t1525)/qCI and unc-32,
cyk-3(t1535)/qCI as described above. Rescue activity was observed at
similar levels to the whole cosmid (6/9 lines). The two cyk-3 alleles
(t1525 and t1535) were sequenced. One single point mutation was found in each
allele, in both cases leading to a premature stop codon. We obtained cDNA
clones yk9h1 and yk226b (kindly provided by Y. Kohara), which covered most of
the cyk-3 coding sequence except for a 5' prime region that had
been predicted by genefinder. ESTs containing the predicted start codon
preceded by a SL1 leader sequence have recently been released. The missing
5' prime end was amplified by PCR from a mixed stage cDNA library.
Sequencing of this reconstructed full-length cDNA revealed that the genomic
sequence of ZK328.1 was incorrect (4 Ts were read as 3 Ts at position 1920 of
the cDNA). The revised cDNA sequence of ZK328.1 has been submitted to GenBank
(accession number AF469173).
RNA interference
We performed RNAi on the predicted genes contained in cosmid ZK328.
Fragments of 280 to 350bp corresponding to the coding regions of these genes
were amplified by PCR and subcloned into pGEM-T (Promega). In vitro
transcription from both strands was performed (Ambion), the strands were
annealed and injected into the gonads of wild-type hermaphrodites as described
previously (Fire et al.,
1998
). Embryos were analyzed 18 hours and 24 hours post injection.
Of the predicted genes of ZK328, only RNAi against ZK328.1 phenocopied
cyk-3 mutant embryos. The ZK328.1 PCR fragment used for RNAi was
amplified with the primers CGTCGCTATGGTTTCCGATTG and
CGATCAAAGGAAGTCCAAAACG.
Antibody staining
Gravid hermaphrodites were placed into a drop of media A on a
polylysine-coated slide. A coverslip was added, and sufficient pressure to
extrude the embryos was applied. The embryos were immediately frozen in liquid
nitrogen and fixed in -20°C methanol, and antibody staining was performed
according to standard protocols. The monoclonal rat anti-tubulin antibody YOL
1/34 was used in a 1:300 dilution. The rabbit anti-PGL-1 antibody was kindly
provided by Susan Strome and used in a 1:1000 dilution.
Phalloidin staining
Gravid hermaphrodites were placed in a drop of fix and stain solution (4%
Paraformaldehyde, 50 mM Pipes pH 6.8, 5 mM EGTA, pH 8 and 300 nM
Rhodamine-labeled Phalloidin (Molecular Probes)) between thin spacers of
vacuum grease on a siliconized slide. A coverslip was added and pressure was
applied to extrude the embryos. Further gentle pressure was applied to
permeabilize the embryos. After 20-30 minutes of incubation at room
temperature, the embryos were washed with PBST (1xPBS and 0.05%
Triton-X100), stained with Hoechst 33342 and analyzed.
Time-lapse analysis and analysis of cytoplasmic flow
Time-lapse Nomarski analysis was performed as described previously
(Jantsch-Plunger and Glotzer,
1999
). To measure the cytoplasmic flow, time-lapse recordings of
three wild-type and three cyk-3 embryos at the pronuclear stage
filmed in medium A were analyzed using Object Image, an extended version of
NIH image software (developed by Norbert Vischer). The movement of individual
yolk granules was followed for 30-40 seconds, and an average speed was
calculated.
Buffers for osmotic support and preparation of blastomeres
Medium A: 5 mg/ml Polyvinylpyrrolidone (PVP), 25 mM Hepes (pH 7.4), 0.5
mg/ml Inulin, 0.06 M NaCl and 0.025 M KCl. Blastomere and embryonic growth
media (EGM) was prepared as described previously
(Edgar, 1995
). The EGM used in
this study was prepared according to the instructions for Minimal EGM. In
order to vary the osmolarity, the medium was supplemented with either half
(0.5xEGM) or double (2xEGM) concentration of stock salts. Calcein
(Molecular Probes) was used at a concentration of 10 µM and the membrane
staining dye FM4-64 (Molecular Probes) at a concentration of 5 µg/ml.
Deubiquitination assay
Ubiquitin (cosmid Z1010) and the ubiquitin-like proteins encoded by cosmid
K12C11 (SUMO ortholog), H06I04 and F45H11 (NEDD8 ortholog) were amplified by
PCR from a mixed stage cDNA library and subcloned into the LacZ expression
vector pPD8.02 (Fire et al.,
1990
), thereby creating a N-terminal fusion of ubiquitin to
ß-galactosidase (ß-Gal). To distinguish between bacterially
expressed ß-Gal and ß-Gal expressed from the vector, a 620 bp
HpaI fragment was removed, creating a truncated version of
ß-Galactosidase (ß-Gal
). Doa4p was amplified from S.
cerevisiae (W303) genomic DNA by PCR and subcloned into pET28a. The
cyk-3 cDNA was also subcloned into pET28a. The ß-Gal fusion
proteins were co-expressed together with either Doa4p or CYK-3 in
Escherichia coli BL21. Cleavage of ubiquitin or ubiquitin-like
proteins from the ubiquitin-ß-Gal
HpaI fusion protein was
assessed by probing for ß-Gal with an anti-ß-gal antibody (Promega)
on a western blot.
| Results |
|---|
|
|
|---|
In order to analyze the mutant phenotype in more detail, we performed time-lapse Nomarski microscopy on embryos produced from cyk-3 homozygous hermaphrodites (n=11). Using osmotically balanced medium A (see Materials and Methods), we followed embryos from the onset of pronuclear migration to the completion of mitosis (Fig. 1). We observed a similar phenotype in dissected embryos (Fig. 1a) and on embryos in utero (Fig. 1b). The first defect observed is a lack of membrane contractions and a failure to perform pseudocleavage (100%). Pseudocleavage is a transient ingression of the plasma membrane that occurs during pronuclear migration. An additional penetrant defect observed is the inability of cyk-3 embryos to extrude polar bodies, which contain the remnants of the meiotic divisions of the maternal pronucleus. Polar bodies are normally extruded from the embryo proper by a highly asymmetric form of cytokinesis.
|
Subsequent steps in early embryonic development, such as pronuclear meeting, rotation of the nuclear-centrosome complex and nuclear division, appear to be normal in cyk-3 embryos. We measured the time interval between the first and the second occurrence of nuclear envelope breakdown in wildtype and cyk-3 mutant embryos and found that they complete one cell cycle in approximately the same time (17.5±1.5 minutes and 20.3±0.5 minutes, respectively). In anaphase, however, cyk-3 mutant embryos show a striking defect: they do not form a cleavage furrow, and they therefore fail to undergo cytokinesis (Fig. 1).
These observations suggest that several actin-dependent processes during
early embryonic development are impaired. The lack of any visible membrane
contractions, the absence of pseudocleavage and the absence of cytokinesis are
reminiscent of phenotypes observed in early embryos upon treatment with
actin-disrupting drugs such as cytochalasin
(Strome and Wood, 1983
).
Processes that depend on microtubules, such as pronuclear migration and
rotation of the pronuclei-centrosome complex, as well as chromosome
segregation, appear normal in cyk-3 embryos.
Embryonic polarity of cyk-3 mutant embryos is partly
disturbed
Since actin-dependent processes are impaired in cyk-3 mutant
embryos, we tested whether embryonic polarity, which requires a functional
actin cytoskeleton, is also affected. Embryonic polarity was monitored in two
ways, either by analyzing the localization of P-granules or by determining the
position of the mitotic spindle in the first embryonic cell cycle.
We examined the localization of P-granules by staining fixed embryos with
an antibody directed against PGL-1, a protein component of P-granules
(Kawasaki et al., 1998
).
During pronuclear meeting, P-granules become localized to the posterior cortex
of wild-type embryos where they remain during mitosis
(Fig. 2). In subsequent
divisions they are segregated into the P-lineage. In cyk-3 embryos,
P-granules are frequently mislocalized. From pronuclear meeting until
telophase of the first mitosis, P-granules are not localized to the posterior
cortex but cluster at approximately the middle of the embryos (11/12 embryos)
(Fig. 2).
|
During the first mitotic division of wild-type embryos, the mitotic spindle is displaced towards the posterior hemisphere. To determine the extent of posterior displacement we measured anaphase spindles at maximal elongation relative to egg length and found that wild-type spindles are positioned at 0.55 egg length (n=5). Mitotic spindles in cyk-3 mutant embryos are also positioned at 0.55 egg length (n=5). These findings show that different aspects of polarity are differently disturbed in cyk-3 embryos. Whereas the mitotic spindle is positioned correctly, P-granules are mislocalized.
The actin cytoskeleton of cyk-3 embryos is defective
In early C. elegans zygotes, actin forms a uniform cortical
network of fibers and foci. During pronuclear formation and migration, the
actin cytoskeleton undergoes a dramatic redistribution that correlates with
membrane contractions and pseudocleavage. At the time of pronuclear meeting,
the majority of filamentous actin is localized to the anterior hemisphere,
forming a structure called the `anterior cap'
(Strome, 1986
)
(Fig. 3a) (n=5/6).
Although cyk-3 mutant embryos have an apparently normal uniform
network of actin prior to pronuclear migration, the redistribution of the
actin cytoskeleton does not occur. Instead, cyk-3 embryos maintain a
uniform distribution of filamentous actin around the cortex (n=4/4)
(Fig. 3a). The failure to
redistribute actin might account for the lack of membrane contractions and
pseudocleavage.
|
During late anaphase, a contractile ring containing actin and myosin is formed in wild-type embryos. As cells proceed through mitosis, this ring contracts, furrowing the overlying plasma membrane and thereby dividing the cell into two daughter cells (Fig. 3b) (n=6/6). Focusing on the surface of late telophase cyk-3 embryos, we found that a partial actin ring is formed at the correct position, slightly displaced to the posterior half of the embryo (Fig. 3b) (n=7/9). This finding indicates that the initiation of cytokinesis is not impaired in cyk-3 mutant embryos.
The rearrangement of the actin cytoskeleton in the early C.
elegans embryo is concomitant with a cytoplasmic rearrangement, termed
cytoplasmic flow, that is visualized by directed movement of yolk granules
before and during pronuclear migration. Actomyosin-dependent cortical flow
from the posterior to the anterior of the embryo induces streaming in the
opposite direction in the interior of the embryo
(Hird and White, 1993
;
Shelton et al., 1999
). Since
we observe defects of the actin cytoskeleton in cyk-3 embryos
precisely at the time when cytoplasmic flow occurs in wild-type embryos, we
tested whether the movement of yolk granules is impaired in cyk-3
embryos. We measured the rate of movement of the streaming of 90 individual
granules from several wild-type or cyk-3 mutant embryos. Although we
observed a directed cytoplasmic flow in wild-type embryos with an average
speed of 6±2 µm/minute, polarized movement of granules did not occur
in cyk-3 mutant embryos. Instead, in cyk-3 embryos, granules
moved with an average speed of 1±0.6 µm/minute in an apparently
non-directional manner.
Optimized in vitro conditions partially rescue the cytokinesis defect
observed in vivo
Apart from phenotypes related to the actin cytoskeleton, cyk-3
mutant embryos are osmosensitive as well as sensitive to mechanical pressure.
During the course of our actin staining, we also found that cyk-3
mutant embryos are readily permeable to dyes. These characteristics are also
found in wild-type embryos that are deprived of their eggshell.
In order to test whether mechano- and osmosensitivity can account for the
cytokinesis phenotype observed in vivo, we analyzed the behavior of
cyk-3 mutant embryos under optimized in vitro conditions. We defined
optimal in vitro conditions as conditions in which isolated wild-type
blastomeres divide normally. Wild-type embryos were deprived of their eggshell
and cultured in Embryonic Growth Medium (EGM) (see Materials and Methods). In
this medium, wild-type cells perform cytokinesis normally
(Fig. 4a). Cells of the P
lineage divide along the a-p axes forming an elongated `neck'
(Fig. 4a, arrow)
(Edgar, 1995
). AB daughter
cells divide in a spiral cleavage pattern that results in a `ball' of cells
(Fig. 4a, arrowhead). In the
same medium and in the absence of mechanical pressure, cyk-3 mutant
embryos are capable of forming cleavage furrows that constrict the membrane
and divide the zygote (Fig. 4) (n=16/18). However, the rescue of the cytokinesis defect is
incomplete. Even though these embryos cellularize to some extent, individual
cells often contain more than one nucleus, and the embryos remain swollen.
Consistent with this observation, we did not find any mutant embryo that
developed until hatching.
|
Even though optimal osmotic conditions together with the absence of mechanical pressure do not rescue the lethality of cyk-3 mutant embryos, the process of cytokinesis itself is restored under these conditions. The cleavage furrows that form appear weak (in wild-type embryos, the ingressing cleavage furrow creates a prominent gap between the embryo and the eggshell; this gap is small or nonexistent in cyk-3 mutant embryos), but they never regress and create distinct cells. We therefore conclude that the `cytokinesis machinery' is not affected in cyk-3 embryos. Thus, the cytokinesis defect is a secondary defect caused by osmosensitivity and sensitivity to mechanical pressure.
cyk-3 mutant embryos have an intrinsic osmotic defect
independent of defective extra-embryonic structures
Wild-type embryos are protected from their environment by an eggshell that
is composed of an outer layer (vitelline), a chitinous middle layer and a
lipid-rich inner layer (Rappleye et al.,
1999
; Schierenberg and
Junkersdorf, 1992
). The chitin layer provides mechanical support
and gives the embryo its typical ellipsoid shape. Wild-type embryos whose
chitin layer has been removed round up and become very sensitive to mechanical
stress. The inner lipid-rich layer acts as a solvent barrier. Upon disruption
or removal of this innermost layer, embryos are rendered permeable to dyes and
sensitive to the osmotic conditions of their environment. Since cyk-3
mutant embryos are both permeable and sensitive to their environment, it is
likely that the inner lipid-rich layer is either absent or defective.
It is conceivable that defective extra-embryonic structures cause the osmosensitivity of the embryos. If this is the case, then cyk-3 embryos should behave the same as wild-type embryos whose eggshell has been disrupted. To test this prediction, we disrupted the eggshell of wild-type embryos and compared the behavior of these permeabilized wild-type embryos with the behavior of cyk-3 embryos under different osmotic conditions. To disrupt the lipid layer of wild-type embryos, pressure was gently applied to a coverslip, thereby cracking the eggshell of the embryos underneath. Permeabilization of the embryos was monitored using the vital dyes FM4-64 and calcein. FM4-64 was used to stain membrane structures, whereas calcein was used as a marker for viability. As a medium we used EGM, supplemented with different amounts of stock salts to change the osmolarity.
Wild-type embryos cracked in hypotonic medium (0.5xEGM) immediately swell. Additionally, cleavage furrows between two cells frequently disappear, and the remaining furrows constrict the membrane only weakly, presumably because of the higher turgor inside the embryo (Fig. 5a). Wild-type embryos under these conditions closely resemble cyk-3 mutant embryos, which also appear swollen and furrow weakly (Fig. 5a).
|
Under isotonic conditions, in 1xEGM, wild-type embryos have a normal morphology; they neither swell nor shrink (Fig. 5b). The embryo consists of several viable, round cells. Under the same conditions, cyk-3 embryos remain swollen, showing only weak furrowing (Fig. 5b). cyk-3 embryos in 1xEGM appear similar to wild-type and cyk-3 embryos in 0.5xEGM.
Wild-type embryos cracked in hypertonic medium (2xEGM) rapidly shrink (Fig. 5c). Large gaps appear between the remnants of the eggshell and the embryo. cyk-3 embryos subjected to the same conditions do not react by shrinking. No gaps are observed between the eggshell and the embryo. cyk-3 mutant embryos fail to adjust to the osmotic shock, and large creases are usually observed on the surface of the embryo (Fig. 5c).
In contrast to wild-type embryos whose eggshell has been disrupted, cyk-3 mutant embryos barely respond to changes in the osmolarity of their environment. We therefore conclude that, apart from the apparent defect of the extra-embryonic structures, cyk-3 embryos have an intrinsic cellular defect in regulating the response to osmotic stress.
cyk-3 encodes an ubiquitin C-terminal hydrolase
Using recombination mapping and testing of appropriate genomic
deficiencies, we positioned cyk-3 in the interval between
sma-4 and the breakpoint of sDf125 on LGIII, very close to
sma-4 (Fig. 6a).
Functional rescue experiments were then used to further narrow the region. One
cosmid from this region, ZK328, had rescuing activity. Using RNA interference
against the predicted open reading frames of ZK328, we provisionally
identified ZK328.1 as the gene encoding cyk-3, since its
depletion caused both osmosensitivity and cytokinesis defects. To verify this
candidate, we subcloned a genomic DNA fragment containing only the predicted
gene and a promoter region into a plasmid and injected this construct. We
obtained rescue activity to the same levels as with the whole cosmid. Sequence
analysis of the two cyk-3 alleles t1525 and t1535
revealed that each allele contained a single point mutation, in both cases
leading to a premature stop codon (Fig.
6b). t1525 is predicted to terminate the protein at amino
acid 98 and is therefore probably a null allele (the other allele terminates
the protein at residue 720; these alleles are phenotypically
indistinguishable).
|
The sequence of ZK328.1 indicates that cyk-3 is a ubiquitin C-terminal hydrolase, a deubiquitinating enzyme of the UBP family of deubiquitinating enzymes. CYK-3 contains a C-terminal UCH domain, consisting of a Cys (UCH1) and a His box (UCH2). In addition it contains an N-terminal EF-hand domain (Fig. 6a,b).
CYK-3 is a functional enzyme that specifically cleaves
ubiquitin-fusion proteins
In order to determine whether CYK-3 is a functional enzyme capable of
removing ubiquitin from a substrate, we co-expressed CYK-3 protein and, as a
substrate, linear ubiquitin-ß-galactosidase fusion proteins in bacteria.
Ubiquitin was fused to the N-terminus of a truncated version of
ß-galactosidase (ß-gal
HpaI). We used truncated
ß-galactosidase in order to distinguish our fusion protein from the
endogenous ß-galactosidase expressed in bacteria. We monitored
deubiquitination by probing for ß-gal with anti-ß-gal antibody on a
western blot. As shown in Fig.
7, CYK-3 cleaves ubiquitin from the
ubiquitin-ß-gal
HpaI fusion with a similar efficiency to
yeast Doa4p. Doa4p has previously been shown to cleave ubiquitin in a similar
assay (Papa and Hochstrasser,
1993
).
|
Using the same assay, we also tested whether CYK-3 or Doa4p are specific
for ubiquitin or whether either of them could also recognize a substrate
targeted with a ubiquitin-like protein. We fused the C. elegans
orthologs of the human ubiquitin-like proteins SUMO and NEDD8 to
ß-gal
HpaI and found that neither CYK-3 nor Doa4p cleave
any of these fusion proteins (Fig.
7). Another ubiquitin-like protein encoded by cosmid H06I08 is
also not recognized by CYK-3 or Doa4p.
These results demonstrate that CYK-3 is a functional enzyme, a C-terminal hydrolase specific for recognizing and cleaving ubiquitinated substrates.
| Discussion |
|---|
|
|
|---|
cyk-3 mutant embryos are defective in osmoregulation
C. elegans embryos are normally protected from the outside
environment by an extra-embryonic structure, commonly known as the eggshell.
At present, not much is known about the origin of the eggshell or its
molecular architecture. However, early studies on related nematodes
(Wharton, 1980
) combined with
recent high resolution electron microscopy of C. elegans eggshells
(Rappleye et al., 1999
) show
that the eggshell is composed of three different layers. An outermost layer, a
chitinous layer and an inner lipid-rich layer. The most important layer for
the embryo is the innermost layer. Embryos deprived of the two outer layers
can still develop until hatching, but upon damage or removal of the innermost
layer, embryos lose patterning information and develop into `monsters'
(Schierenberg and Junkersdorf,
1992
). Additionally, the inner lipid-rich layer renders the embryo
impermeable to vital dyes and provides protection from the osmotic conditions
in the environment. We have found that cyk-3 embryos are readily
permeable to vital dyes and that they are exquisitely sensitive to osmotic
conditions. Therefore, we conclude that the inner lipid-rich layer is
compromised. Apart from the permeability defect, cyk-3 mutant embryos
respond differently to osmotic changes in the environment compared with
wild-type embryos whose lipid-rich layer has been disrupted. Thus,
cyk-3 mutant embryos are defective in cellular osmoregulation.
Moreover, we speculate that the internal pressure caused by the swelling may
have prevented proper formation of the lipid-rich layer or, alternatively,
disrupted it shortly after fertilization.
The defect in osmoregulation may or may not be the primary defect in
cyk-3 mutant embryos. However, it is certainly unlikely that CYK-3
acts directly in regulating the actin cytoskeleton and that the defects in
osmoregulation are a consequence of the disrupted actin cytoskeleton. Embryos
with a highly defective actomyosin cytoskeleton owing to depletion, by RNAi,
of non-muscle myosin or actin are not obviously osmosensitive
(Gönczy et al., 2000
;
Guo and Kemphues, 1996
;
Shelton et al., 1999
). Thus we
conclude that the defects in actin-dependent processes in cyk-3
mutant embryos do not cause the osmosensitivity phenotype.
Conversely, defects in osmoregulation perturb the actin cytoskeleton. When
wild-type embryos are placed in hypotonic conditions, cytokinesis defects are
observed, indicating that drastic changes in the cellular osmotic state can
affect actin-dependent processes. Moreover, cyk-3 embryos, either in
utero or dissected into medium A, have many of the hallmarks of embryos
treated with actin depolymerizing drugs; they are cytokinesis defective and
fail to perform pseudocleavage. In addition, we do not observe polarized
cytoplasmic flow. Regarding embryonic polarity, we find that the segregation
of the P-granules to the posterior hemisphere is impaired in cyk-3
mutant embryos. Asymmetric positioning of the mitotic spindle during the first
cell cycle, on the other hand, occurs normally. Both processes have been shown
to be actin dependent (Strome and Hill,
1988
). At present, we do not know why one process is disturbed
whereas the other is not.
The phenotype of cyk-3 mutant embryos is somewhat similar to the
phenotype of pod-1 mutant embryos. pod-1 encodes a
coronin-like protein that binds to filamentous actin. Embryos lacking POD-1
display a variety of actin-related phenotypes, including loss of embryonic
polarity and frequent failure of cytokinesis
(Rappleye et al., 1999
).
Additionally, pod-1 mutants are osmotically sensitive, indicating
that osmoregulation and the regulation of the actin cytoskeleton are
connected. In contrast to cyk-3 embryos, however, pod-1
embryos shrink in hypertonic medium, suggesting that the osmotic response in
these cells is functional. Therefore, in contrast to cyk-3 embryos,
pod-1 mutant embryos may be osmosensitive solely as a consequence of
disrupted extra-embryonic structures.
Exposing cyk-3 mutant embryos to optimized in vitro conditions allows cytokinesis to proceed, albeit not with high efficiency. This is in dramatic contrast to embryos observed in utero, which do not exhibit any furrowing activity. Thus, the uterus of C. elegans hermaphrodites is not an osmotically ideal environment. Moreover, the uterine contractions subject embryos to strong mechanical stress. Therefore, it may be beneficial to observe osmosensitive embryos both in utero and in optimized in vitro conditions.
CYK-3 probably reverses the ubiquitination of a small number of
substrates
The ubiquitin pathway for intracellular protein degradation is involved in
a wide range of cellular functions, ranging from cell cycle regulation
(Glotzer et al., 1991
) to
transcriptional regulation (Chen et al.,
1993
) to regulation of endocytosis
(Hicke and Riezman, 1996
) (for
a review, see Hochstrasser,
1996
). The biochemical machinery that comprises the ubiquitin
pathway is complex. Proteins are targeted for degradation by the proteasome
complex by chains of ubiquitin monomers. To build ubiquitin chains, a monomer
is first activated by the E1 enzyme from which it is transferred to a
ubiquitin-conjugating enzyme, E2. Transfer to the target protein or to the end
of a growing ubiquitin chain is catalyzed by E3 ubiquitin ligases. The
ubiquitin C-terminal hydrolases (UCH) catalyze the reverse reaction -
disassembly and/or removal of multiubiquitin chains. Although the ubiquitin
conjugation machinery has been extensively studied, the ubiquitin C-terminal
hydrolases are less well understood (for a review, see
Wilkinson and Hochstrasser,
1998
).
A loss of function mutation of an UCH would be expected to lead to
increased amounts of one or more ubiquitin-modified target protein(s). If
these ubiquitin moieties act as degradation signals then loss of function of
the UCH would cause more rapid degradation of the target protein. This would
affect the pathway(s) that require that specific target protein. There is one
example of a UCH functioning in this manner. During development of the
Drosophila eye, the UCH encoded by the fat facets (faf) gene
is required for proper cell fate determination
(Huang et al., 1995
).
Importantly, this function can be suppressed by mutations in a proteasome
subunit gene, suggesting that faf acts to stabilize one or more
substrates. Indeed, the epsin homolog encoded by the liquid facets is a good
candidate for being a critical substrate of faf
(Cadavid et al., 2000
).
However, UCHs can act in the protein degradation pathway in a different way.
Yeast Doa4p is required for proteosome-dependent proteolysis and to recycle
ubiquitin chains to maintain a pool of free ubiquitin
(Papa et al., 1999
;
Papa and Hochstrasser, 1993
;
Swaminathan et al., 1999
).
Mutation of this type of UCH leads to pleiotropic defects in protein
degradation. Since cell cycle timing and nuclear division occur with near
normal kinetics in cyk-3 mutant embryos, it appears unlikely that
CYK-3 plays a role in general protein degradation. If CYK-3 is involved in
ubiquitin-mediated protein degradation, we suggest that it functions by
removing ubiquitin moieties from a specific protein (or from a small number of
targets) that is involved in the osmoregulation of early C. elegans
embryos.
A third possibility for CYK-3 function is that it regulates
ubiquitin-mediated receptor internalization. A number of membrane proteins
have been shown to be mono- or diubiquitinated upon ligand binding. This
modification is essential for their internalization and subsequent degradation
by the lysosome (for a review, see Hicke,
1999
). A role for CYK-3 in endocytosis and degradation via the
lysosomal compartment would also be consistent with the observation that
general protein degradation is not impaired in cyk-3 mutant
embryos.
Possible targets of CYK-3
At present, we can only speculate about the possible targets of CYK-3.
Since cyk-3 mutant embryos are mechano- and osmosensitive, ion
channels and osmolyte transporters are possible CYK-3 targets. As mentioned
above, there are reports of membrane proteins regulated by ubiquitination. The
mammalian epithelial Na+ channel is downregulated via
ubiquitination of two of its subunits
(Staub et al., 1997
).
Defective regulation of the epithelial Na+ channel is implicated in
several human diseases, including Liddle's syndrome, an inherited form of
hypertension (Abriel et al.,
1999
). The C. elegans degenerins are orthologs of the
mammalian epithelial Na+ Channel proteins
(Mano and Driscoll, 1999
).
Mutations in these genes result in neuronal swelling and degeneration
(Driscoll and Chalfie, 1991
),
leading to defects in locomotion. Since homozygous cyk-3 adults move
normally, we think it is unlikely that these particular Na+
channels are targets of CYK-3 regulation. Indeed, animals homozygous for null
mutations in cyk-3 are indistinguishable from wild-type animals
except that their progeny are inviable; CYK-3 appears essential only in the
early embryo. Perhaps embryos require a specialized machinery for
osmoregulation as the ratio of surface area to volume is particularly low in
embryonic cells. Though technically demanding, one method to discover CYK-3
targets is to use electrophysiological methods to determine whether particular
channels or transporters are absent in cyk-3 mutant embryos. Recent
analysis of membrane transporters in early C. elegans embryos and
oocytes has shown the feasibility of such analysis
(Rutledge et al., 2001
).
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Abriel, H., Loffing, J., Rebhun, J. F., Pratt, J. H., Schild, L., Horisberger, J. D., Rotin, D. and Staub, O. (1999). Defective regulation of the epithelial Na+ channel by Nedd4 in Liddle's syndrome. J. Clin. Invest. 103,667 -673.[Medline]
Cadavid, A. L., Ginzel, A. and Fischer, J. A. (2000). The function of the Drosophila fat facets deubiquitinating enzyme in limiting photoreceptor cell number is intimately associated with endocytosis. Development 127,1727 -1736.[Abstract]
Carter, S. B. (1967). Effects of cytochalasins on mammalian cells. Nature 213,261 -264.[Medline]
Chen, P., Johnson, P., Sommer, T., Jentsch, S. and Hochstrasser, M. (1993). Multiple ubiquitin-conjugating enzymes participate in the in vivo degradation of the yeast MAT alpha 2 repressor. Cell 74,357 -369.[Medline]
Chowdhury, S., Smith, K. W. and Gustin, M. C.
(1992). Osmotic stress and the yeast cytoskeleton:
phenotype-specific suppression of an actin mutation. J. Cell
Biol. 118,561
-571.
Coue, M., Brenner, S. L., Spector, I. and Korn, E. D. (1987). Inhibition of actin polymerization by latrunculin A. FEBS Lett. 213,316 -318.[Medline]
Driscoll, M. and Chalfie, M. (1991). The mec-4 gene is a member of a family of Caenorhabditis elegans genes that can mutate to induce neuronal degeneration. Nature 349,588 -593.[Medline]
Edgar, L. (1995). Blastomere Culture and Analysis. In Caenorhabditis elegans: Modern biological analysis of an organism (eds H. F. Epstein and D. C. Shakes), pp.303 -322. NY: Academic Press.
Fire, A., Harrison, S. W. and Dixon, D. (1990). A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans. Gene 93,189 -198.[Medline]
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.Nature 391,806 -811.[Medline]
Glotzer, M. (2001). Animal cell cytokinesis. Annu. Rev. Cell. Dev. Biol. 17,351 -386.[Medline]
Glotzer, M., Murray, A. W. and Kirschner, M. W. (1991). Cyclin is degraded by the ubiquitin pathway. Nature 349,132 -138.[Medline]
Gönczy, P., Schnabel, H., Kaletta, T., Amores, A. D.,
Hyman, T. and Schnabel, R. (1999). Dissection of cell
division processes in the one cell stage Caenorhabditis elegans
embryo by mutational analysis. J. Cell Biol.
144,927
-946.
Gönczy, P., Echeverri, G., Oegema, K., Coulson, A., Jones, S. J., Copley, R. R., Duperon, J., Oegema, J., Brehm, M., Cassin, E. et al. (2000). Functional genomic analysis of cell division in C. elegans using RNAi of genes on chromosome III. Nature 408,331 -336.[Medline]
Guo, S. and Kemphues, K. J. (1996). A non-muscle myosin required for embryonic polarity in Caenorhabditis elegans. Nature 382,455 -458.[Medline]
Hallows, K. R., Law, F. Y., Packman, C. H. and Knauf, P. A. (1996). Changes in cytoskeletal actin content, F-actin distribution, and surface morphology during HL-60 cell volume regulation. J. Cell Physiol. 167,60 -71.[Medline]
Hicke, L. (1999). Gettin' down with ubiquitin: turning off cell-surface receptors, transporters and channels. Trends Cell Biol. 9,107 -112.[Medline]
Hicke, L. and Riezman, H. (1996). Ubiquitination of a yeast plasma membrane receptor signals its ligand-stimulated endocytosis. Cell 84,277 -287.[Medline]
Hird, S. N. and White, J. G. (1993). Cortical
and cytoplasmic flow polarity in early embryonic cells of Caenorhabditis
elegans. J. Cell Biol. 121,1343
-1355.
Hochstrasser, M. (1996). Ubiquitin-dependent protein degradation. Annu. Rev. Genet 30,405 -439.[Medline]
Huang, Y., Baker, R. T. and Fischer-Vize, J. A.
(1995). Control of cell fate by a deubiquitinating enzyme encoded
by the fat facets gene. Science
270,1828
-1831.
Jantsch-Plunger, V. and Glotzer, M. (1999). Depletion of syntaxins in the early Caenorhabditis elegans embryo reveals a role for membrane fusion events in cytokinesis. Curr. Biol. 9,738 -745.[Medline]
Kawasaki, I., Shim, Y. H., Kirchner, J., Kaminker, J., Wood, W. B. and Strome, S. (1998). PGL-1, a predicted RNA-binding component of germ granules, is essential for fertility in C. elegans.Cell 94,635 -645.[Medline]
Kuwayama, H., Ecke, M., Gerisch, G. and van Haastert, P. J. (1996). Protection against osmotic stress by cGMP-mediated myosin phosphorylation. Science 271,207 -209.[Abstract]
Kwon, H. M. and Handler, J. S. (1995). Cell volume regulated transporters of compatible osmolytes. Curr. Opin. Cell Biol. 7,465 -471.[Medline]
Mabuchi, I. and Okuno, M. (1977). The effect of
myosin antibody on the division of starfish blastomeres. J. Cell
Biol. 74,251
-263.
Mano, I. and Driscoll, M. (1999). DEG/ENaC channels: a touchy superfamily that watches its salt. BioEssays 21,568 -578.[Medline]
Mello, C. C., Kramer, J. M., Stinchcomb, D. and Ambros, V. (1991). Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10,3959 -3970.[Medline]
Nishiwaki, K., Sano, T. and Miwa, J. (1993). emb-5, a gene required for the correct timing of gut precursor cell division during gastrulation in Caenorhabditis elegans, encodes a protein similar to the yeast nuclear protein SPT6. Mol. Gen. Genet. 239,313 -322.[Medline]
Papa, F. R., Amerik, A. Y. and Hochstrasser, M.
(1999). Interaction of the Doa4 deubiquitinating enzyme with the
yeast 26S proteasome. Mol. Biol. Cell
10,741
-756.
Papa, F. R. and Hochstrasser, M. (1993). The yeast DOA4 gene encodes a deubiquitinating enzyme related to a product of the human tre-2 oncogene. Nature 366,313 -319.[Medline]
Rappleye, C. A., Paredez, A. R., Smith, C. W., McDonald, K. L.
and Aroian, R. V. (1999). The coronin-like protein POD-1 is
required for anterior-posterior axis formation and cellular architecture in
the nematode Caenorhabditis elegans. Genes Dev.
13,2838
-2851.
Rutledge, E., Bianchi, L., Christensen, M., Boehmer, C., Morrison, R., Broslat, A., Beld, A. M., George, A. L., Greenstein, D. and Strange, K. (2001). CLH-3, a CIC-2 anion channel ortholog activated during meiotic maturation in C. elegans oocytes. Curr. Biol. 11,161 -170.[Medline]
Schierenberg, E. and Junkersdorf, B. (1992). The role of eggshell and underlying vitelline membrane for normal pattern formation in the early C. elegans embryo. Roux's Arch. Dev. Biol. 202,10 -16.
Shelton, C. A., Carter, J. C., Ellis, G. C. and Bowerman, B.
(1999). The nonmuscle myosin regulatory light chain gene mlc-4 is
required for cytokinesis, anterior-posterior polarity, and body morphology
during Caenorhabditis elegans embryogenesis. J. Cell
Biol. 146,439
-451.
Staub, O., Gautschi, I., Ishikawa, T., Breitschopf, K., Ciechanover, A., Schild, L. and Rotin, D. (1997). Regulation of stability and function of the epithelial Na+ channel (ENaC) by ubiquitination. EMBO J. 16,6325 -6336.[Medline]
Strome, S. (1986). Fluorescence visualization
of the distribution of microfilaments in gonads and early embryos of the
nematode Caenorhabditis elegans. J. Cell Biol.
103,2241
-2252.
Strome, S. and Hill, D. P. (1988). Early embryogenesis in Caenorhabditis elegans: the cytoskeleton and spatial organization of the zygote. BioEssays 8, 145-149.[Medline]
Strome, S. and Wood, W. B. (1983). Generation of asymmetry and segregation of germ-line granules in early C. elegans embryos. Cell 35, 15-25.[Medline]
Swaminathan, S., Amerik, A. Y. and Hochstrasser, M.
(1999). The Doa4 deubiquitinating enzyme is required for
ubiquitin homeostasis in yeast. Mol. Biol. Cell
10,2583
-2594.
Wharton, D. (1980). Nematode egg-shells. Parasitology 81,447 -463.[Medline]
Wilkinson, K. and Hochstrasser, M. (1998). The Deubiquitinating Enzymes. In Ubiquitin and the Biology of the Cell (eds J.-M. Peters, J. R. Harris and D. Finley), pp.99 -125. New York: Plenum Press.
Zischka, H., Oehme, F., Pintsch, T., Ott, A., Keller, H., Kellermann, J. and Schuster, S. C. (1999). Rearrangement of cortex proteins constitutes an osmoprotective mechanism in Dictyostelium.EMBO J. 18,4241 -4249.[Medline]
This article has been cited by other articles:
![]() |
J. N. Bembenek, C. T. Richie, J. M. Squirrell, J. M. Campbell, K. W. Eliceiri, D. Poteryaev, A. Spang, A. Golden, and J. G. White Cortical granule exocytosis in C. elegans is regulated by cell cycle components including separase Development, November 1, 2007; 134(21): 3837 - 3848. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liegeois, A. Benedetto, G. Michaux, G. Belliard, and M. Labouesse Genes Required for Osmoregulation and Apical Secretion in Caenorhabditis elegans Genetics, February 1, 2007; 175(2): 709 - 724. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Lamitina, R. Morrison, G. W. Moeckel, and K. Strange Adaptation of the nematode Caenorhabditis elegans to extreme osmotic stress Am J Physiol Cell Physiol, April 1, 2004; 286(4): C785 - C791. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||