spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kucharczyk, R.
Right arrow Articles by Rytka, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kucharczyk, R.
Right arrow Articles by Rytka, J.

The Ccz1 protein interacts with Ypt7 GTPase during fusion of multiple transport intermediates with the vacuole in S. cerevisiae

za Kucharczyk1, Andrzej M. Kierzek1, P. P. Slonimski2 and Joanna Rytka1,*

1 Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5A, 02-106 Warsaw, Poland
2 Centre de Genetique Moleculaire, CNRS, F-91198, Gif-sur-Yvette, France



View larger version (5K):

[in a new window]
 
Fig. 1. Position of primers used for PCR mutagenesis of YPT7 gene. x, indicates the ypt7D129A mutation. The first base of the YPT7 gene (A to ATG codon) is designated +1. Nucleotide positions refer to the first 5' base of oligonucleotide homologous to genomic DNA. For details see Materials and Methods. The sequences of the primers: oRK25: 5'GGAATAACCTCAGAACTCAC3'; oRK26: 5'TTGAAAGGGCCATCACATCC3'; oRK28: 5'TGCTGCCGAAGAATCTAA3' (the changed base is bold and underlined); oYPT1: 5'AATACTTATCATTGACA3'.

 


View larger version (40K):

[in a new window]
 
Fig. 2. Suppression of ccz1{Delta} phenotypes by representatives of the ypt7 mutants. (1) CCZ1/CCZ1; (2) ccz1{Delta}/ccz1{Delta}; (3) ccz1{Delta}/ccz1{Delta}, YPT/ypt7K127E. Cells were grown for 2 days at 28°C in YPD medium. For each strain tested, four serial 33-fold dilutions were made starting from 1x108 cells/ml dilution. 5 µl aliquots of second, third and fourth dilutions were spotted onto YPD plates supplemented with 500 mM CaCl2, 5.14 mM caffeine and 5 mM ZnCl2. Pictures were taken after 4 days of incubation at 28°C.

 


View larger version (65K):

[in a new window]
 
Fig. 3. The ypt7 suppressors restore wild-type morphology of vacuoles. Abnormal vacuolar morphology of ccz1{Delta}/ccz1{Delta} cells (B), compared with wild-type CCZ1/CCZ1 (A) and suppressed cells ccz1{Delta}/ccz1{Delta} YPT7/ypt7K127E (C). Vacuoles were labelled with ade2 endogenous fluorophore. Cells were viewed by Nomarski optics (left) and the same fields were viewed for fluorescence (right). Wild-type vacuoles appear as large fluorescent spots corresponding to circular indentation in Nomarski. Vacuoles of mutant cells appear as numerous, fluorescent spots corresponding to irregular structures in Nomarski.

 


View larger version (42K):

[in a new window]
 
Fig. 4. Guanine binding site of the YPT7 protein (I) and sequence alignment used during the homology modeling (II). (I) A, the wild-type protein. B,C,D,E,F,G the D129G, D129N, K127E, A159P, T157P and D129A mutated proteins, respectively. Residues belonging to GNKID and TSAK motif are marked blue. GDP is shown in purple and Tyr 33 in orange. The hydrogen bonds between Asp129 and the guanine base and Asp129 and Ser158 are marked. (II) G1 to G5 conserved residues are bold.

 


View larger version (130K):

[in a new window]
 
Fig. 5. The zinc sensitivity of ccz1{Delta} cells bearing mutated alleles of YPT7 gene. (1) CCZ1/CCZ1; (2) ccz1{Delta}/ccz1{Delta}; (3) ccz1{Delta}/ccz1{Delta}, YPT/ypt7K127E; (4) ccz1{Delta}/ccz1{Delta} [ypt7K127E CEN]; (5) ccz1{Delta}/ccz1{Delta} [ypt7D129A CEN]; (6) ccz1{Delta}/ccz1{Delta} [YPT7 2µ]; (7) ccz1{Delta}/ccz1{Delta} [YPT7 CEN]; (8) ccz1{Delta}/ccz1{Delta} [ypt7Q68L CEN]; (9) ccz1{Delta}/ccz1{Delta} [ypt7T22N CEN].

 


View larger version (20K):

[in a new window]
 
Fig. 6. Physical association of Ccz1p with Ypt7p. Total extracts from yeast cells were immunoprecipitated with anti-HA antibody as described in Materials and Methods. Total extracts, 3 µl (A), and immunoprecipitates from 1 ml of extracts (B) were analyzed by SDS-PAGE and immunoblotting with anti-HA antibody (upper panel) to detect Ccz1-HAp and with antiserum to Ypt7p (lower panel). The band corresponding for Ccz1-Hap is not detectable even for 20 µl of extracts loaded on gel. Lanes represent preparations from strains: (1) ypt7{Delta}; (2) ccz1{Delta} [YPT7]; (3) ccz1{Delta} [YPT7/CCZ1-HA]; (4) ccz1{Delta} [ypt7K127E /CCZ1-HA]; (5) ccz1{Delta} [ypt7Q68L/CCZ1-HA]; (6) ccz1{Delta} [ypt7T22N /CCZ1-HA]. The double bands visible for Ypt7K127Ep probably represent geranylgeranylated and unmodified forms.

 





© The Company of Biologists Ltd 2001